EMAIL THIS PAGE TO A FRIEND

RARS2

arginyl-tRNA synthetase 2, mitochondrial

Synonyms: ArgRS DALRD2 PCH6 PRO1992 RARSL dJ382I10.6
UniProtKB ID: Q5T160, B2RDT7, Q96FU5, Q9H8K8
Gene ID:
Human(57038) Summary: The protein encoded by this gene is an arginyl-tRNA synthetase that is found in the mitochondrial matrix. Defects in this gene are a cause of pontocerebellar hypoplasia type 6 (PCH6). [provided by RefSeq, Oct 2008]
Mouse(109093) arginyl-tRNA synthetase 2, mitochondrial
Rat(297969) arginyl-tRNA synthetase 2, mitochondrial
Zebrafish(393589) arginyl-tRNA synthetase 2, mitochondrial (putative)
chicken(421823) arginyl-tRNA synthetase 2, mitochondrial
domestic cat(101089519) arginyl-tRNA synthetase 2, mitochondrial
Horse(100070665) arginyl-tRNA synthetase 2, mitochondrial
dog(481911) arginyl-tRNA synthetase 2, mitochondrial
cow(525894) arginyl-tRNA synthetase 2, mitochondrial
sheep(101112906) arginyl-tRNA synthetase 2, mitochondrial
domestic guinea pig(100727299) arginyl-tRNA synthetase 2, mitochondrial
Domestic Rabbit(100348236) arginyl-tRNA synthetase 2, mitochondrial
naked mole-rat(101701322) arginyl-tRNA synthetase 2, mitochondrial
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020320 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020320 Rosetta Predictions human pricing
NM_001106643 Rosetta Predictions rat pricing
NM_181406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119277 predicted 206
2 SASI_Hs01_00119279 predicted 1134
3 SASI_Hs02_00353245 predicted 239
4 SASI_Hs01_00119280 predicted 1344
5 SASI_Hs01_00119282 predicted 1108
6 SASI_Hs01_00119283 predicted 515
7 SASI_Hs01_00119284 predicted 986
8 SASI_Hs01_00119285 predicted 1253
9 SASI_Hs01_00119286 predicted 277
10 SASI_Hs02_00353246 predicted 1290
11 SASI_Hs01_00119278 predicted 352
12 SASI_Hs01_00119281 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220968 predicted 444
2 SASI_Rn02_00220969 predicted 1474
3 SASI_Rn02_00220970 predicted 1070
4 SASI_Rn02_00220971 predicted 851
5 SASI_Rn02_00220972 predicted 1087
6 SASI_Rn02_00220973 predicted 781
7 SASI_Rn02_00220974 predicted 1580
8 SASI_Rn02_00220975 predicted 405
9 SASI_Rn02_00220976 predicted 1320
10 SASI_Rn02_00220977 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154317 predicted 889
2 SASI_Mm01_00154318 predicted 334
3 SASI_Mm01_00154319 predicted 1239
4 SASI_Mm01_00154321 predicted 1023
5 SASI_Mm01_00154322 predicted 846
6 SASI_Mm02_00349754 predicted 381
7 SASI_Mm01_00154323 predicted 727
8 SASI_Mm01_00154324 predicted 390
9 SASI_Mm01_00154325 predicted 497
10 SASI_Mm02_00349755 predicted 573
11 SASI_Mm01_00154320 predicted 1334
12 SASI_Mm01_00154326 predicted 1224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020320
VALIDATED
RARS2 MISSION shRNA Bacterial Glycerol Stock
arginyl-tRNA synthetase 2, mitochondrial
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020320.2-481s1c1
Sequence:CCGGGCGTTCTACCATCATAGGAAACTCGAGTTTCCTATGATGGTAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020320.2-967s1c1
Sequence:CCGGCTCCTCAATTTGTACTGTAATCTCGAGATTACAGTACAAATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_020320.2-1597s1c1
Sequence:CCGGACCCAGGCATATCGTCAGTTACTCGAGTAACTGACGATATGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020320.2-291s1c1
Sequence:CCGGGTACTGGTCAAAGGACTGTAACTCGAGTTACAGTCCTTTGACCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020320.2-1173s1c1
Sequence:CCGGCCTTTGGAGTAGTACAGGGAACTCGAGTTCCCTGTACTACTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020320.2-967s1c2
Sequence:CCGGCTCCTCAATTTGTACTGTAATCTCGAGATTACAGTACAAATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-1275s21c1
Sequence:CCGGACAGAACATGGCTTCAATTAACTCGAGTTAATTGAAGCCATGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-1367s21c1
Sequence:CCGGACTTCAAAGGTTTACTCTTATCTCGAGATAAGAGTAAACCTTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-537s21c1
Sequence:CCGGAGCTTTAGGACATCAAGTAATCTCGAGATTACTTGATGTCCTAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-357s21c1
Sequence:CCGGGACAGTGCTACAACAAGTAATCTCGAGATTACTTGTTGTAGCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-140s21c1
Sequence:CCGGCAATATCTGCAGTTCCAATTTCTCGAGAAATTGGAACTGCAGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-1055s21c1
Sequence:CCGGATCGAATGGACAAGTATAATTCTCGAGAATTATACTTGTCCATTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-827s21c1
Sequence:CCGGACAAGCGTCTGGGAGTATATTCTCGAGAATATACTCCCAGACGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020320
VALIDATED
RARS2 MISSION shRNA shRNA Plasmid DNA
arginyl-tRNA synthetase 2, mitochondrial
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020320.2-481s1c1
Sequence:CCGGGCGTTCTACCATCATAGGAAACTCGAGTTTCCTATGATGGTAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020320.2-967s1c1
Sequence:CCGGCTCCTCAATTTGTACTGTAATCTCGAGATTACAGTACAAATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_020320.2-1597s1c1
Sequence:CCGGACCCAGGCATATCGTCAGTTACTCGAGTAACTGACGATATGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020320.2-291s1c1
Sequence:CCGGGTACTGGTCAAAGGACTGTAACTCGAGTTACAGTCCTTTGACCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020320.2-1173s1c1
Sequence:CCGGCCTTTGGAGTAGTACAGGGAACTCGAGTTCCCTGTACTACTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020320.2-967s1c2
Sequence:CCGGCTCCTCAATTTGTACTGTAATCTCGAGATTACAGTACAAATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-1275s21c1
Sequence:CCGGACAGAACATGGCTTCAATTAACTCGAGTTAATTGAAGCCATGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-1367s21c1
Sequence:CCGGACTTCAAAGGTTTACTCTTATCTCGAGATAAGAGTAAACCTTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-537s21c1
Sequence:CCGGAGCTTTAGGACATCAAGTAATCTCGAGATTACTTGATGTCCTAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-357s21c1
Sequence:CCGGGACAGTGCTACAACAAGTAATCTCGAGATTACTTGTTGTAGCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-140s21c1
Sequence:CCGGCAATATCTGCAGTTCCAATTTCTCGAGAAATTGGAACTGCAGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-1055s21c1
Sequence:CCGGATCGAATGGACAAGTATAATTCTCGAGAATTATACTTGTCCATTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-827s21c1
Sequence:CCGGACAAGCGTCTGGGAGTATATTCTCGAGAATATACTCCCAGACGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020320
VALIDATED
RARS2 MISSION shRNA Lentiviral Transduction Particles
arginyl-tRNA synthetase 2, mitochondrial
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020320.2-481s1c1
Sequence:CCGGGCGTTCTACCATCATAGGAAACTCGAGTTTCCTATGATGGTAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020320.2-967s1c1
Sequence:CCGGCTCCTCAATTTGTACTGTAATCTCGAGATTACAGTACAAATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_020320.2-1597s1c1
Sequence:CCGGACCCAGGCATATCGTCAGTTACTCGAGTAACTGACGATATGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020320.2-291s1c1
Sequence:CCGGGTACTGGTCAAAGGACTGTAACTCGAGTTACAGTCCTTTGACCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020320.2-1173s1c1
Sequence:CCGGCCTTTGGAGTAGTACAGGGAACTCGAGTTCCCTGTACTACTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020320.2-967s1c2
Sequence:CCGGCTCCTCAATTTGTACTGTAATCTCGAGATTACAGTACAAATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-1275s21c1
Sequence:CCGGACAGAACATGGCTTCAATTAACTCGAGTTAATTGAAGCCATGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-1367s21c1
Sequence:CCGGACTTCAAAGGTTTACTCTTATCTCGAGATAAGAGTAAACCTTTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-537s21c1
Sequence:CCGGAGCTTTAGGACATCAAGTAATCTCGAGATTACTTGATGTCCTAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-357s21c1
Sequence:CCGGGACAGTGCTACAACAAGTAATCTCGAGATTACTTGTTGTAGCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-140s21c1
Sequence:CCGGCAATATCTGCAGTTCCAATTTCTCGAGAAATTGGAACTGCAGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-1055s21c1
Sequence:CCGGATCGAATGGACAAGTATAATTCTCGAGAATTATACTTGTCCATTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020320.3-827s21c1
Sequence:CCGGACAAGCGTCTGGGAGTATATTCTCGAGAATATACTCCCAGACGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181406
VALIDATED
RARS2 MISSION shRNA Bacterial Glycerol Stock
arginyl-tRNA synthetase 2, mitochondrial
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181406.2-1238s1c1
Sequence:CCGGGCTTCCATTAAGACCACGAAACTCGAGTTTCGTGGTCTTAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181406.2-1054s1c1
Sequence:CCGGCAAAGGGCAAAGAAGGCATTTCTCGAGAAATGCCTTCTTTGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181406.2-893s1c1
Sequence:CCGGGAGGGAAATGTTGTAGTAGATCTCGAGATCTACTACAACATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181406.2-42s1c1
Sequence:CCGGCCTGTCAGCTTTCCAGAGTATCTCGAGATACTCTGGAAAGCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181406.2-890s1c1
Sequence:CCGGGCGGAGGGAAATGTTGTAGTACTCGAGTACTACAACATTTCCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1522s21c1
Sequence:CCGGCAGGTTCGATGAGGTACTTTACTCGAGTAAAGTACCTCATCGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1604s21c1
Sequence:CCGGCTTGCAGCTGTGGCACATAAACTCGAGTTTATGTGCCACAGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1579s21c1
Sequence:CCGGTAGCTACCTCCTAACTCTAAGCTCGAGCTTAGAGTTAGGAGGTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1238s21c1
Sequence:CCGGGCTTCCATTAAGACCACGAAACTCGAGTTTCGTGGTCTTAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-893s21c1
Sequence:CCGGGAGGGAAATGTTGTAGTAGATCTCGAGATCTACTACAACATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.3-1542s21c1
Sequence:CCGGCAGGTTTGATGAGGTACTTTACTCGAGTAAAGTACCTCATCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.3-1028s21c1
Sequence:CCGGATCGCATGGACAAGTACAATTCTCGAGAATTGTACTTGTCCATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.3-357s21c1
Sequence:CCGGTGGCTGTAAATATGGGTTAAACTCGAGTTTAACCCATATTTACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181406
VALIDATED
RARS2 MISSION shRNA shRNA Plasmid DNA
arginyl-tRNA synthetase 2, mitochondrial
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181406.2-1238s1c1
Sequence:CCGGGCTTCCATTAAGACCACGAAACTCGAGTTTCGTGGTCTTAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181406.2-1054s1c1
Sequence:CCGGCAAAGGGCAAAGAAGGCATTTCTCGAGAAATGCCTTCTTTGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181406.2-893s1c1
Sequence:CCGGGAGGGAAATGTTGTAGTAGATCTCGAGATCTACTACAACATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181406.2-42s1c1
Sequence:CCGGCCTGTCAGCTTTCCAGAGTATCTCGAGATACTCTGGAAAGCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181406.2-890s1c1
Sequence:CCGGGCGGAGGGAAATGTTGTAGTACTCGAGTACTACAACATTTCCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1522s21c1
Sequence:CCGGCAGGTTCGATGAGGTACTTTACTCGAGTAAAGTACCTCATCGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1604s21c1
Sequence:CCGGCTTGCAGCTGTGGCACATAAACTCGAGTTTATGTGCCACAGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1579s21c1
Sequence:CCGGTAGCTACCTCCTAACTCTAAGCTCGAGCTTAGAGTTAGGAGGTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1238s21c1
Sequence:CCGGGCTTCCATTAAGACCACGAAACTCGAGTTTCGTGGTCTTAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-893s21c1
Sequence:CCGGGAGGGAAATGTTGTAGTAGATCTCGAGATCTACTACAACATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.3-1542s21c1
Sequence:CCGGCAGGTTTGATGAGGTACTTTACTCGAGTAAAGTACCTCATCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.3-1028s21c1
Sequence:CCGGATCGCATGGACAAGTACAATTCTCGAGAATTGTACTTGTCCATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.3-357s21c1
Sequence:CCGGTGGCTGTAAATATGGGTTAAACTCGAGTTTAACCCATATTTACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181406
VALIDATED
RARS2 MISSION shRNA Lentiviral Transduction Particles
arginyl-tRNA synthetase 2, mitochondrial
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181406.2-1238s1c1
Sequence:CCGGGCTTCCATTAAGACCACGAAACTCGAGTTTCGTGGTCTTAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181406.2-1054s1c1
Sequence:CCGGCAAAGGGCAAAGAAGGCATTTCTCGAGAAATGCCTTCTTTGCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181406.2-893s1c1
Sequence:CCGGGAGGGAAATGTTGTAGTAGATCTCGAGATCTACTACAACATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181406.2-42s1c1
Sequence:CCGGCCTGTCAGCTTTCCAGAGTATCTCGAGATACTCTGGAAAGCTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181406.2-890s1c1
Sequence:CCGGGCGGAGGGAAATGTTGTAGTACTCGAGTACTACAACATTTCCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1522s21c1
Sequence:CCGGCAGGTTCGATGAGGTACTTTACTCGAGTAAAGTACCTCATCGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1604s21c1
Sequence:CCGGCTTGCAGCTGTGGCACATAAACTCGAGTTTATGTGCCACAGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1579s21c1
Sequence:CCGGTAGCTACCTCCTAACTCTAAGCTCGAGCTTAGAGTTAGGAGGTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-1238s21c1
Sequence:CCGGGCTTCCATTAAGACCACGAAACTCGAGTTTCGTGGTCTTAATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.2-893s21c1
Sequence:CCGGGAGGGAAATGTTGTAGTAGATCTCGAGATCTACTACAACATTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.3-1542s21c1
Sequence:CCGGCAGGTTTGATGAGGTACTTTACTCGAGTAAAGTACCTCATCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.3-1028s21c1
Sequence:CCGGATCGCATGGACAAGTACAATTCTCGAGAATTGTACTTGTCCATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181406.3-357s21c1
Sequence:CCGGTGGCTGTAAATATGGGTTAAACTCGAGTTTAACCCATATTTACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks