EMAIL THIS PAGE TO A FRIEND

RASGRP1

RAS guanyl releasing protein 1 (calcium and DAG-regulated)

Synonyms: CALDAG-GEFI CALDAG-GEFII RASGRP V hRasGRP1
Gene ID:
Human(10125) Summary: This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
Mouse(19419) RAS guanyl releasing protein 1
Rat(29434) RAS guanyl releasing protein 1 (calcium and DAG-regulated)
chicken(423290) RAS guanyl releasing protein 1 (calcium and DAG-regulated)
domestic cat(101093110) RAS guanyl releasing protein 1 (calcium and DAG-regulated)
Horse(100071578) RAS guanyl releasing protein 1 (calcium and DAG-regulated)
dog(478255) RAS guanyl releasing protein 1 (calcium and DAG-regulated)
domestic guinea pig(100735488) RAS guanyl releasing protein 1 (calcium and DAG-regulated)
naked mole-rat(101699646) RAS guanyl releasing protein 1 (calcium and DAG-regulated)
Domestic Rabbit(100359319) RAS guanyl releasing protein 1 (calcium and DAG-regulated)
cow(533125) RAS guanyl releasing protein 1 (calcium and DAG-regulated)
sheep(101105504) RAS guanyl releasing protein 1 (calcium and DAG-regulated)
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005739 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005739 Rosetta Predictions human pricing
NM_019211 Rosetta Predictions rat pricing
NM_011246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340180 predicted 2394
2 SASI_Hs01_00199645 predicted 960
3 SASI_Hs01_00199646 predicted 339
4 SASI_Hs01_00199647 predicted 2449
5 SASI_Hs01_00199648 predicted 1846
6 SASI_Hs01_00199649 predicted 426
7 SASI_Hs01_00199650 predicted 763
8 SASI_Hs01_00199651 predicted 2501
9 SASI_Hs01_00199652 predicted 1795
10 SASI_Hs01_00199653 predicted 1044
11 SASI_Hs01_00199644 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053653 predicted 388
2 SASI_Rn01_00053654 predicted 1088
3 SASI_Rn01_00053655 predicted 1883
4 SASI_Rn01_00053656 predicted 1388
5 SASI_Rn01_00053657 predicted 2089
6 SASI_Rn01_00053658 predicted 2319
7 SASI_Rn01_00053659 predicted 655
8 SASI_Rn01_00053660 predicted 821
9 SASI_Rn01_00053661 predicted 810
10 SASI_Rn02_00262052 predicted 502
11 SASI_Rn01_00053662 predicted 2021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191903 predicted 2037
2 SASI_Mm01_00191904 predicted 2574
3 SASI_Mm01_00191905 predicted 830
4 SASI_Mm01_00191906 predicted 2540
5 SASI_Mm01_00191907 predicted 1652
6 SASI_Mm02_00320237 predicted 1586
7 SASI_Mm01_00191908 predicted 2424
8 SASI_Mm01_00191909 predicted 1871
9 SASI_Mm01_00191910 predicted 2108
10 SASI_Mm01_00191911 predicted 2579
11 SASI_Mm01_00191902 predicted 1951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011246
RASGRP1 MISSION shRNA Bacterial Glycerol Stock
RAS guanyl releasing protein 1 (calcium and DAG-regulated)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011246.2-2869s21c1
Sequence:CCGGGCCCGCTTTACTGATTCATACCTCGAGGTATGAATCAGTAAAGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011246.2-1412s21c1
Sequence:CCGGTATCCCTGGATCTATACTATACTCGAGTATAGTATAGATCCAGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011246.2-2348s21c1
Sequence:CCGGAGAACAAAGAGTCCCTTATAACTCGAGTTATAAGGGACTCTTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011246.2-2960s1c1
Sequence:CCGGCCCGCTCATAACGGAAACAATCTCGAGATTGTTTCCGTTATGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-409s1c1
Sequence:CCGGCGGAATAACCAACTGTTACAACTCGAGTTGTAACAGTTGGTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-1321s1c1
Sequence:CCGGGCCCTTTACAATCATATCAATCTCGAGATTGATATGATTGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-864s1c1
Sequence:CCGGCCTTGTAAATAGCTGCGTAAACTCGAGTTTACGCAGCTATTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-2463s1c1
Sequence:CCGGCCAACTGAAGTACGCACAGAACTCGAGTTCTGTGCGTACTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011246
RASGRP1 MISSION shRNA shRNA Plasmid DNA
RAS guanyl releasing protein 1 (calcium and DAG-regulated)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011246.2-2869s21c1
Sequence:CCGGGCCCGCTTTACTGATTCATACCTCGAGGTATGAATCAGTAAAGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011246.2-1412s21c1
Sequence:CCGGTATCCCTGGATCTATACTATACTCGAGTATAGTATAGATCCAGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011246.2-2348s21c1
Sequence:CCGGAGAACAAAGAGTCCCTTATAACTCGAGTTATAAGGGACTCTTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011246.2-2960s1c1
Sequence:CCGGCCCGCTCATAACGGAAACAATCTCGAGATTGTTTCCGTTATGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-409s1c1
Sequence:CCGGCGGAATAACCAACTGTTACAACTCGAGTTGTAACAGTTGGTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-1321s1c1
Sequence:CCGGGCCCTTTACAATCATATCAATCTCGAGATTGATATGATTGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-864s1c1
Sequence:CCGGCCTTGTAAATAGCTGCGTAAACTCGAGTTTACGCAGCTATTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-2463s1c1
Sequence:CCGGCCAACTGAAGTACGCACAGAACTCGAGTTCTGTGCGTACTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011246
RASGRP1 MISSION shRNA Lentiviral Transduction Particles
RAS guanyl releasing protein 1 (calcium and DAG-regulated)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011246.2-2869s21c1
Sequence:CCGGGCCCGCTTTACTGATTCATACCTCGAGGTATGAATCAGTAAAGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011246.2-1412s21c1
Sequence:CCGGTATCCCTGGATCTATACTATACTCGAGTATAGTATAGATCCAGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011246.2-2348s21c1
Sequence:CCGGAGAACAAAGAGTCCCTTATAACTCGAGTTATAAGGGACTCTTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011246.2-2960s1c1
Sequence:CCGGCCCGCTCATAACGGAAACAATCTCGAGATTGTTTCCGTTATGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-409s1c1
Sequence:CCGGCGGAATAACCAACTGTTACAACTCGAGTTGTAACAGTTGGTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-1321s1c1
Sequence:CCGGGCCCTTTACAATCATATCAATCTCGAGATTGATATGATTGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-864s1c1
Sequence:CCGGCCTTGTAAATAGCTGCGTAAACTCGAGTTTACGCAGCTATTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011246.2-2463s1c1
Sequence:CCGGCCAACTGAAGTACGCACAGAACTCGAGTTCTGTGCGTACTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005739
RASGRP1 MISSION shRNA Bacterial Glycerol Stock
RAS guanyl releasing protein 1 (calcium and DAG-regulated)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005739.3-2590s21c1
Sequence:CCGGACAATCTGTAGATGAGTATAGCTCGAGCTATACTCATCTACAGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005739.3-444s21c1
Sequence:CCGGTGCTGACCATGCACCGAATTGCTCGAGCAATTCGGTGCATGGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005739.3-1417s21c1
Sequence:CCGGGACGTTATCCCTGGATCTTTACTCGAGTAAAGATCCAGGGATAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-602s1c1
Sequence:CCGGCGCCTGATTGACACAACTCAACTCGAGTTGAGTTGTGTCAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-161s1c1
Sequence:CCGGGCTGCCTCTAAAGCAAGACTACTCGAGTAGTCTTGCTTTAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-2393s1c1
Sequence:CCGGGCCCTAAAGATCCAACTGAAACTCGAGTTTCAGTTGGATCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-799s1c1
Sequence:CCGGCCTTGTAAATAGCTGTGTGAACTCGAGTTCACACAGCTATTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-1228s1c1
Sequence:CCGGCGGGAAAGTGAACGTCCATAACTCGAGTTATGGACGTTCACTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005739
RASGRP1 MISSION shRNA shRNA Plasmid DNA
RAS guanyl releasing protein 1 (calcium and DAG-regulated)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005739.3-2590s21c1
Sequence:CCGGACAATCTGTAGATGAGTATAGCTCGAGCTATACTCATCTACAGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005739.3-444s21c1
Sequence:CCGGTGCTGACCATGCACCGAATTGCTCGAGCAATTCGGTGCATGGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005739.3-1417s21c1
Sequence:CCGGGACGTTATCCCTGGATCTTTACTCGAGTAAAGATCCAGGGATAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-602s1c1
Sequence:CCGGCGCCTGATTGACACAACTCAACTCGAGTTGAGTTGTGTCAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-161s1c1
Sequence:CCGGGCTGCCTCTAAAGCAAGACTACTCGAGTAGTCTTGCTTTAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-2393s1c1
Sequence:CCGGGCCCTAAAGATCCAACTGAAACTCGAGTTTCAGTTGGATCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-799s1c1
Sequence:CCGGCCTTGTAAATAGCTGTGTGAACTCGAGTTCACACAGCTATTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-1228s1c1
Sequence:CCGGCGGGAAAGTGAACGTCCATAACTCGAGTTATGGACGTTCACTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005739
RASGRP1 MISSION shRNA Lentiviral Transduction Particles
RAS guanyl releasing protein 1 (calcium and DAG-regulated)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005739.3-2590s21c1
Sequence:CCGGACAATCTGTAGATGAGTATAGCTCGAGCTATACTCATCTACAGATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005739.3-444s21c1
Sequence:CCGGTGCTGACCATGCACCGAATTGCTCGAGCAATTCGGTGCATGGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005739.3-1417s21c1
Sequence:CCGGGACGTTATCCCTGGATCTTTACTCGAGTAAAGATCCAGGGATAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-602s1c1
Sequence:CCGGCGCCTGATTGACACAACTCAACTCGAGTTGAGTTGTGTCAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-161s1c1
Sequence:CCGGGCTGCCTCTAAAGCAAGACTACTCGAGTAGTCTTGCTTTAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-2393s1c1
Sequence:CCGGGCCCTAAAGATCCAACTGAAACTCGAGTTTCAGTTGGATCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-799s1c1
Sequence:CCGGCCTTGTAAATAGCTGTGTGAACTCGAGTTCACACAGCTATTTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005739.2-1228s1c1
Sequence:CCGGCGGGAAAGTGAACGTCCATAACTCGAGTTATGGACGTTCACTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks