EMAIL THIS PAGE TO A FRIEND

RASGRP4

RAS guanyl releasing protein 4

Gene ID:
Human(115727) Summary: The protein encoded by this gene is a member of the Ras guanyl nucleotide-releasing protein (RasGRP) family of Ras guanine nucleotide exchange factors. It contains a Ras exchange motif, a diacylglycerol-binding domain, and two calcium-binding EF hands. This protein was shown to activate H-Ras in a cation-dependent manner in vitro. Expression of this protein in myeloid cell lines was found to be correlated with elevated level of activated RAS protein, and the RAS activation can be greatly enhanced by phorbol ester treatment, which suggested a role of this protein in diacylglycerol regulated cell signaling pathways. Studies of a mast cell leukemia cell line expressing substantial amounts of abnormal transcripts of this gene indicated that this gene may play an important role in the final stages of mast cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Mouse(233046) RAS guanyl releasing protein 4
Rat(170668) RAS guanyl releasing protein 4
cow(529375) RAS guanyl releasing protein 4
sheep(101112342) RAS guanyl releasing protein 4
Domestic Rabbit(100350559) RAS guanyl releasing protein 4
naked mole-rat(101708596) RAS guanyl releasing protein 4
domestic guinea pig(100727572) RAS guanyl releasing protein 4
Zebrafish(558453) RAS guanyl releasing protein 4
domestic cat(101094467) RAS guanyl releasing protein 4
dog(484528) RAS guanyl releasing protein 4
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170604 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_052949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052949 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052949 Rosetta Predictions human pricing
NM_170602 Rosetta Predictions human pricing
NM_170603 Rosetta Predictions human pricing
NM_170604 Rosetta Predictions human pricing
NM_130824 Rosetta Predictions rat pricing
NM_145149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036076 predicted 332
2 SASI_Hs01_00036077 predicted 286
3 SASI_Hs01_00036078 predicted 327
4 SASI_Hs01_00036079 predicted 700
5 SASI_Hs01_00036080 predicted 1136
6 SASI_Hs01_00036081 predicted 1133
7 SASI_Hs01_00036082 predicted 757
8 SASI_Hs01_00036083 predicted 591
9 SASI_Hs01_00036084 predicted 521
10 SASI_Hs01_00036085 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124936 predicted 1433
2 SASI_Hs01_00124937 predicted 1721
3 SASI_Hs01_00124938 predicted 1802
4 SASI_Hs01_00124939 predicted 1606
5 SASI_Hs01_00124940 predicted 1813
6 SASI_Hs01_00124941 predicted 1859
7 SASI_Hs01_00124942 predicted 1427
8 SASI_Hs01_00124943 predicted 335
9 SASI_Hs01_00124944 predicted 1621
10 SASI_Hs01_00124945 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217053 predicted 1477
2 SASI_Hs01_00217054 predicted 1764
3 SASI_Hs01_00217055 predicted 1841
4 SASI_Hs01_00217056 predicted 1654
5 SASI_Hs01_00217057 predicted 1865
6 SASI_Hs01_00217058 predicted 1900
7 SASI_Hs01_00217059 predicted 1460
8 SASI_Hs01_00217060 predicted 328
9 SASI_Hs01_00217061 predicted 1664
10 SASI_Hs01_00217062 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367550 predicted 694
2 SASI_Hs01_00052629 predicted 1470
3 SASI_Hs02_00367551 predicted 1849
4 SASI_Hs01_00052630 predicted 1764
5 SASI_Hs02_00367552 predicted 2056
6 SASI_Hs02_00367553 predicted 2184
7 SASI_Hs02_00367554 predicted 581
8 SASI_Hs01_00052631 predicted 1831
9 SASI_Hs01_00052632 predicted 1646
10 SASI_Hs01_00052633 predicted 1859
11 SASI_Hs01_00052634 predicted 1904
12 SASI_Hs01_00052635 predicted 1460
13 SASI_Hs01_00052636 predicted 330
14 SASI_Hs01_00052637 predicted 1672
15 SASI_Hs01_00052638 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122327 predicted 1248
2 SASI_Rn02_00267518 predicted 1867
3 SASI_Rn01_00122328 predicted 978
4 SASI_Rn01_00122329 predicted 349
5 SASI_Rn01_00122330 predicted 1238
6 SASI_Rn01_00122332 predicted 1713
7 SASI_Rn01_00122333 predicted 1767
8 SASI_Rn01_00122335 predicted 1289
9 SASI_Rn02_00267519 predicted 1417
10 SASI_Rn02_00267520 predicted 472
11 SASI_Rn01_00122331 predicted 842
12 SASI_Rn01_00122334 predicted 756
13 SASI_Rn01_00122336 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035705 predicted 2518
2 SASI_Mm01_00035707 predicted 1336
3 SASI_Mm01_00035708 predicted 409
4 SASI_Mm01_00035709 predicted 2467
5 SASI_Mm01_00035710 predicted 2461
6 SASI_Mm01_00035711 predicted 424
7 SASI_Mm01_00035713 predicted 1835
8 SASI_Mm01_00035714 predicted 801
9 SASI_Mm02_00340554 predicted 895
10 SASI_Mm02_00340555 predicted 439
11 SASI_Mm01_00035706 predicted 2559
12 SASI_Mm01_00035712 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145149
RASGRP4 MISSION shRNA Bacterial Glycerol Stock
RAS guanyl releasing protein 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145149.3-1207s21c1
Sequence:CCGGTGCACCTACCCAAGCTGAATACTCGAGTATTCAGCTTGGGTAGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145149.3-1540s21c1
Sequence:CCGGCCATCTCTCTGGAGGACTTTGCTCGAGCAAAGTCCTCCAGAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145149.3-656s21c1
Sequence:CCGGGCGGAAAGTGTCATTGCTATTCTCGAGAATAGCAATGACACTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-1127s1c1
Sequence:CCGGCCACAACAACTATGCCCACTACTCGAGTAGTGGGCATAGTTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-327s1c1
Sequence:CCGGGAGGAATGTATCCGCTGCTTTCTCGAGAAAGCAGCGGATACATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-479s1c1
Sequence:CCGGCCAAGAGCTAAGACAGCTACACTCGAGTGTAGCTGTCTTAGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-567s1c1
Sequence:CCGGGAAGCAGTCATAAGCCGGTTTCTCGAGAAACCGGCTTATGACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-1380s1c1
Sequence:CCGGGATCTCTTCTACACGGAAGATCTCGAGATCTTCCGTGTAGAAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145149
RASGRP4 MISSION shRNA shRNA Plasmid DNA
RAS guanyl releasing protein 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145149.3-1207s21c1
Sequence:CCGGTGCACCTACCCAAGCTGAATACTCGAGTATTCAGCTTGGGTAGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145149.3-1540s21c1
Sequence:CCGGCCATCTCTCTGGAGGACTTTGCTCGAGCAAAGTCCTCCAGAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145149.3-656s21c1
Sequence:CCGGGCGGAAAGTGTCATTGCTATTCTCGAGAATAGCAATGACACTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-1127s1c1
Sequence:CCGGCCACAACAACTATGCCCACTACTCGAGTAGTGGGCATAGTTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-327s1c1
Sequence:CCGGGAGGAATGTATCCGCTGCTTTCTCGAGAAAGCAGCGGATACATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-479s1c1
Sequence:CCGGCCAAGAGCTAAGACAGCTACACTCGAGTGTAGCTGTCTTAGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-567s1c1
Sequence:CCGGGAAGCAGTCATAAGCCGGTTTCTCGAGAAACCGGCTTATGACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-1380s1c1
Sequence:CCGGGATCTCTTCTACACGGAAGATCTCGAGATCTTCCGTGTAGAAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145149
RASGRP4 MISSION shRNA Lentiviral Transduction Particles
RAS guanyl releasing protein 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145149.3-1207s21c1
Sequence:CCGGTGCACCTACCCAAGCTGAATACTCGAGTATTCAGCTTGGGTAGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145149.3-1540s21c1
Sequence:CCGGCCATCTCTCTGGAGGACTTTGCTCGAGCAAAGTCCTCCAGAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145149.3-656s21c1
Sequence:CCGGGCGGAAAGTGTCATTGCTATTCTCGAGAATAGCAATGACACTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-1127s1c1
Sequence:CCGGCCACAACAACTATGCCCACTACTCGAGTAGTGGGCATAGTTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-327s1c1
Sequence:CCGGGAGGAATGTATCCGCTGCTTTCTCGAGAAAGCAGCGGATACATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-479s1c1
Sequence:CCGGCCAAGAGCTAAGACAGCTACACTCGAGTGTAGCTGTCTTAGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-567s1c1
Sequence:CCGGGAAGCAGTCATAAGCCGGTTTCTCGAGAAACCGGCTTATGACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145149.1-1380s1c1
Sequence:CCGGGATCTCTTCTACACGGAAGATCTCGAGATCTTCCGTGTAGAAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170604
RASGRP4 MISSION shRNA Bacterial Glycerol Stock
RAS guanyl releasing protein 4
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000428852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170604.2-1464s21c1
Sequence:CCGGACACGGAAGACGAGATCTATGCTCGAGCATAGATCTCGTCTTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170604.2-406s21c1
Sequence:CCGGATGCATCCAGTCCTTCGATTCCTCGAGGAATCGAAGGACTGGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170604.2-1629s21c1
Sequence:CCGGAGTCTGTGTTCAAGAATTATGCTCGAGCATAATTCTTGAACACAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170604
RASGRP4 MISSION shRNA shRNA Plasmid DNA
RAS guanyl releasing protein 4
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000428852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170604.2-1464s21c1
Sequence:CCGGACACGGAAGACGAGATCTATGCTCGAGCATAGATCTCGTCTTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170604.2-406s21c1
Sequence:CCGGATGCATCCAGTCCTTCGATTCCTCGAGGAATCGAAGGACTGGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170604.2-1629s21c1
Sequence:CCGGAGTCTGTGTTCAAGAATTATGCTCGAGCATAATTCTTGAACACAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170604
RASGRP4 MISSION shRNA Lentiviral Transduction Particles
RAS guanyl releasing protein 4
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000428852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170604.2-1464s21c1
Sequence:CCGGACACGGAAGACGAGATCTATGCTCGAGCATAGATCTCGTCTTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170604.2-406s21c1
Sequence:CCGGATGCATCCAGTCCTTCGATTCCTCGAGGAATCGAAGGACTGGATGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170604.2-1629s21c1
Sequence:CCGGAGTCTGTGTTCAAGAATTATGCTCGAGCATAATTCTTGAACACAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052949
RASGRP4 MISSION shRNA Bacterial Glycerol Stock
RAS guanyl releasing protein 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-319s1c1
Sequence:CCGGCCCTCGGGAAATCAGCAAGGTCTCGAGACCTTGCTGATTTCCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-517s1c1
Sequence:CCGGCCTGCTGACCTCATACCAGAACTCGAGTTCTGGTATGAGGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-640s1c1
Sequence:CCGGAGAAGAAGTCATAGGTCGTTTCTCGAGAAACGACCTATGACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-244s1c1
Sequence:CCGGCCACCAGGAATGCACCGGAAACTCGAGTTTCCGGTGCATTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052949.2-1181s1c1
Sequence:CCGGGCAGAATTTCAACACGCTGATCTCGAGATCAGCGTGTTGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052949
RASGRP4 MISSION shRNA shRNA Plasmid DNA
RAS guanyl releasing protein 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-319s1c1
Sequence:CCGGCCCTCGGGAAATCAGCAAGGTCTCGAGACCTTGCTGATTTCCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-517s1c1
Sequence:CCGGCCTGCTGACCTCATACCAGAACTCGAGTTCTGGTATGAGGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-640s1c1
Sequence:CCGGAGAAGAAGTCATAGGTCGTTTCTCGAGAAACGACCTATGACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-244s1c1
Sequence:CCGGCCACCAGGAATGCACCGGAAACTCGAGTTTCCGGTGCATTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052949.2-1181s1c1
Sequence:CCGGGCAGAATTTCAACACGCTGATCTCGAGATCAGCGTGTTGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052949
RASGRP4 MISSION shRNA Lentiviral Transduction Particles
RAS guanyl releasing protein 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-319s1c1
Sequence:CCGGCCCTCGGGAAATCAGCAAGGTCTCGAGACCTTGCTGATTTCCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-517s1c1
Sequence:CCGGCCTGCTGACCTCATACCAGAACTCGAGTTCTGGTATGAGGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-640s1c1
Sequence:CCGGAGAAGAAGTCATAGGTCGTTTCTCGAGAAACGACCTATGACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052949.2-244s1c1
Sequence:CCGGCCACCAGGAATGCACCGGAAACTCGAGTTTCCGGTGCATTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052949.2-1181s1c1
Sequence:CCGGGCAGAATTTCAACACGCTGATCTCGAGATCAGCGTGTTGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks