EMAIL THIS PAGE TO A FRIEND

RASSF1

Ras association (RalGDS/AF-6) domain family member 1

Synonyms: 123F2 NORE2A RASSF1A RDA32 REH3P21
Gene ID:
Human(11186) Summary: This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
Mouse(56289) Ras association (RalGDS/AF-6) domain family member 1
Rat(363140) Ras association (RalGDS/AF-6) domain family member 1
Zebrafish(447811) Ras association (RalGDS/AF-6) domain family 1
chicken(101750777) Ras association (RalGDS/AF-6) domain family member 1
dog(607929) Ras association (RalGDS/AF-6) domain family member 1
domestic cat(101094657) Ras association (RalGDS/AF-6) domain family member 1
chicken(101665483) Ras association (RalGDS/AF-6) domain family member 1
cow(510276) Ras association (RalGDS/AF-6) domain family member 1
sheep(100302080) Ras association (RalGDS/AF-6) domain family member 1
domestic guinea pig(100717305) Ras association (RalGDS/AF-6) domain family member 1
naked mole-rat(101707605) Ras association (RalGDS/AF-6) domain family member 1
198 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007182 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007182 Rosetta Predictions human pricing
NM_170712 Rosetta Predictions human pricing
NM_170713 Rosetta Predictions human pricing
NM_170714 Rosetta Predictions human pricing
NM_170715 Rosetta Predictions human pricing
NM_170716 Rosetta Predictions human pricing
NM_170717 Rosetta Predictions human pricing
NM_001007754 Rosetta Predictions rat pricing
NM_001037555 Rosetta Predictions rat pricing
NM_019713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179340 predicted 1347
2 SASI_Hs01_00179341 predicted 1427
3 SASI_Hs02_00343144 predicted 1613
4 SASI_Hs02_00343145 predicted 1425
5 SASI_Hs01_00179344 predicted 1599
6 SASI_Hs02_00343146 predicted 763
7 SASI_Hs01_00179345 predicted 1568
8 SASI_Hs02_00343147 predicted 1093
9 SASI_Hs01_00179346 predicted 1075
10 SASI_Hs01_00179347 predicted 1025
11 SASI_Hs01_00179342 predicted 1001
12 SASI_Hs01_00179343 predicted 1197
13 SASI_Hs01_00179348 predicted 1320
14 SASI_Hs01_00179349 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227059 predicted 1060
2 SASI_Hs01_00227060 predicted 1135
3 SASI_Hs02_00367660 predicted 1317
4 SASI_Hs02_00367661 predicted 1132
5 SASI_Hs01_00227063 predicted 1309
6 SASI_Hs02_00367662 predicted 475
7 SASI_Hs01_00227064 predicted 1278
8 SASI_Hs02_00367663 predicted 807
9 SASI_Hs01_00227065 predicted 791
10 SASI_Hs01_00227066 predicted 740
11 SASI_Hs01_00227061 predicted 711
12 SASI_Hs01_00227062 predicted 907
13 SASI_Hs01_00227067 predicted 1036
14 SASI_Hs01_00227068 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079100 predicted 1151
2 SASI_Hs01_00079101 predicted 1224
3 SASI_Hs02_00367664 predicted 1413
4 SASI_Hs02_00367665 predicted 1227
5 SASI_Hs01_00079104 predicted 1407
6 SASI_Hs02_00367666 predicted 573
7 SASI_Hs01_00079105 predicted 1377
8 SASI_Hs02_00367667 predicted 903
9 SASI_Hs01_00079106 predicted 884
10 SASI_Hs01_00079107 predicted 831
11 SASI_Hs01_00079102 predicted 797
12 SASI_Hs01_00079103 predicted 997
13 SASI_Hs01_00079108 predicted 1130
14 SASI_Hs01_00079109 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109878 predicted 1361
2 SASI_Hs01_00109879 predicted 1438
3 SASI_Hs02_00367668 predicted 1624
4 SASI_Hs02_00367669 predicted 1433
5 SASI_Hs01_00109882 predicted 1612
6 SASI_Hs02_00367670 predicted 779
7 SASI_Hs01_00109883 predicted 1583
8 SASI_Hs02_00367671 predicted 1113
9 SASI_Hs01_00109884 predicted 1087
10 SASI_Hs01_00109885 predicted 1042
11 SASI_Hs01_00109880 predicted 1014
12 SASI_Hs01_00109881 predicted 1209
13 SASI_Hs01_00109886 predicted 1341
14 SASI_Hs01_00109887 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054822 predicted 1370
2 SASI_Hs01_00054823 predicted 1443
3 SASI_Hs01_00054824 predicted 1013
4 SASI_Hs01_00054825 predicted 1209
5 SASI_Hs01_00054826 predicted 1622
6 SASI_Hs01_00054827 predicted 1593
7 SASI_Hs01_00054828 predicted 1091
8 SASI_Hs01_00054829 predicted 1041
9 SASI_Hs01_00054830 predicted 1339
10 SASI_Hs01_00054831 predicted 1552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086790 predicted 895
2 SASI_Hs01_00086791 predicted 462
3 SASI_Hs01_00086792 predicted 313
4 SASI_Hs01_00086793 predicted 486
5 SASI_Hs01_00086794 predicted 667
6 SASI_Hs01_00086795 predicted 408
7 SASI_Hs01_00086796 predicted 658
8 SASI_Hs01_00086797 predicted 219
9 SASI_Hs01_00086798 predicted 406
10 SASI_Hs01_00086799 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032789 predicted 790
2 SASI_Hs01_00032790 predicted 872
3 SASI_Hs01_00032791 predicted 823
4 SASI_Hs01_00032792 predicted 1078
5 SASI_Hs01_00032793 predicted 978
6 SASI_Hs01_00032794 predicted 746
7 SASI_Hs01_00032795 predicted 310
8 SASI_Hs01_00032796 predicted 557
9 SASI_Hs01_00032797 predicted 378
10 SASI_Hs01_00032798 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071769 predicted 571
2 SASI_Rn01_00071770 predicted 572
3 SASI_Rn01_00071771 predicted 534
4 SASI_Rn01_00071772 predicted 560
5 SASI_Rn01_00071773 predicted 438
6 SASI_Rn01_00071774 predicted 572
7 SASI_Rn01_00071775 predicted 411
8 SASI_Rn01_00071776 predicted 492
9 SASI_Rn01_00071777 predicted 715
10 SASI_Rn01_00071778 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093709 predicted 767
2 SASI_Rn01_00093710 predicted 761
3 SASI_Rn01_00093711 predicted 725
4 SASI_Rn01_00093712 predicted 752
5 SASI_Rn01_00093713 predicted 634
6 SASI_Rn01_00093714 predicted 767
7 SASI_Rn01_00093715 predicted 600
8 SASI_Rn01_00093716 predicted 683
9 SASI_Rn01_00093717 predicted 911
10 SASI_Rn01_00093718 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171259 predicted 327
2 SASI_Mm01_00171260 predicted 1135
3 SASI_Mm02_00324826 predicted 1319
4 SASI_Mm01_00171261 predicted 1293
5 SASI_Mm01_00171263 predicted 976
6 SASI_Mm01_00171264 predicted 1358
7 SASI_Mm01_00171266 predicted 531
8 SASI_Mm01_00171267 predicted 640
9 SASI_Mm02_00324827 predicted 392
10 SASI_Mm01_00171268 predicted 1231
11 SASI_Mm01_00171262 predicted 1210
12 SASI_Mm01_00171265 predicted 1204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007182
VALIDATED
RASSF1 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007182.4-602s1c1
Sequence:CCGGCGGTTCTTACACAGGCTTCATCTCGAGATGAAGCCTGTGTAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007182.4-1025s1c1
Sequence:CCGGGCCTGAACTACATAACTTCCTCTCGAGAGGAAGTTATGTAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_007182.4-589s1c1
Sequence:CCGGGCTTGAACAAGGACGGTTCTTCTCGAGAAGAACCGTCCTTGTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-373s21c1
Sequence:CCGGAGTGCGCGCATTGCAAGTTCACTCGAGTGAACTTGCAATGCGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007182.4-822s1c2
Sequence:CCGGCGAAAGTTCTTGGTGGTGGATCTCGAGATCCACCACCAAGAACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-602s21c1
Sequence:CCGGCGGTTCTTACACAGGCTTCATCTCGAGATGAAGCCTGTGTAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-1087s21c1
Sequence:CCGGTCCTGCAGAAGTACTCCTATTCTCGAGAATAGGAGTACTTCTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007182.4-1552s21c1
Sequence:CCGGGTGGTCTCAGGATATCCTTATCTCGAGATAAGGATATCCTGAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-541s21c1
Sequence:CCGGAGAAGATCAAGGAGTACAATGCTCGAGCATTGTACTCCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-1025s21c1
Sequence:CCGGGCCTGAACTACATAACTTCCTCTCGAGAGGAAGTTATGTAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007182.4-1429s21c1
Sequence:CCGGAGACAGAAGTCTCCTCAATTTCTCGAGAAATTGAGGAGACTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007182
VALIDATED
RASSF1 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007182.4-602s1c1
Sequence:CCGGCGGTTCTTACACAGGCTTCATCTCGAGATGAAGCCTGTGTAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007182.4-1025s1c1
Sequence:CCGGGCCTGAACTACATAACTTCCTCTCGAGAGGAAGTTATGTAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_007182.4-589s1c1
Sequence:CCGGGCTTGAACAAGGACGGTTCTTCTCGAGAAGAACCGTCCTTGTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-373s21c1
Sequence:CCGGAGTGCGCGCATTGCAAGTTCACTCGAGTGAACTTGCAATGCGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007182.4-822s1c2
Sequence:CCGGCGAAAGTTCTTGGTGGTGGATCTCGAGATCCACCACCAAGAACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-602s21c1
Sequence:CCGGCGGTTCTTACACAGGCTTCATCTCGAGATGAAGCCTGTGTAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-1087s21c1
Sequence:CCGGTCCTGCAGAAGTACTCCTATTCTCGAGAATAGGAGTACTTCTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007182.4-1552s21c1
Sequence:CCGGGTGGTCTCAGGATATCCTTATCTCGAGATAAGGATATCCTGAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-541s21c1
Sequence:CCGGAGAAGATCAAGGAGTACAATGCTCGAGCATTGTACTCCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-1025s21c1
Sequence:CCGGGCCTGAACTACATAACTTCCTCTCGAGAGGAAGTTATGTAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007182.4-1429s21c1
Sequence:CCGGAGACAGAAGTCTCCTCAATTTCTCGAGAAATTGAGGAGACTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007182
VALIDATED
RASSF1 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007182.4-602s1c1
Sequence:CCGGCGGTTCTTACACAGGCTTCATCTCGAGATGAAGCCTGTGTAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007182.4-1025s1c1
Sequence:CCGGGCCTGAACTACATAACTTCCTCTCGAGAGGAAGTTATGTAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_007182.4-589s1c1
Sequence:CCGGGCTTGAACAAGGACGGTTCTTCTCGAGAAGAACCGTCCTTGTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-373s21c1
Sequence:CCGGAGTGCGCGCATTGCAAGTTCACTCGAGTGAACTTGCAATGCGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007182.4-822s1c2
Sequence:CCGGCGAAAGTTCTTGGTGGTGGATCTCGAGATCCACCACCAAGAACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-602s21c1
Sequence:CCGGCGGTTCTTACACAGGCTTCATCTCGAGATGAAGCCTGTGTAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-1087s21c1
Sequence:CCGGTCCTGCAGAAGTACTCCTATTCTCGAGAATAGGAGTACTTCTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007182.4-1552s21c1
Sequence:CCGGGTGGTCTCAGGATATCCTTATCTCGAGATAAGGATATCCTGAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-541s21c1
Sequence:CCGGAGAAGATCAAGGAGTACAATGCTCGAGCATTGTACTCCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007182.4-1025s21c1
Sequence:CCGGGCCTGAACTACATAACTTCCTCTCGAGAGGAAGTTATGTAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007182.4-1429s21c1
Sequence:CCGGAGACAGAAGTCTCCTCAATTTCTCGAGAAATTGAGGAGACTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019713
VALIDATED
RASSF1 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019713.2-628s1c1
Sequence:CCGGCCTCGCAAGTTTGCACTCTTTCTCGAGAAAGAGTGCAAACTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019713.2-640s1c1
Sequence:CCGGGCACTCTTTGAGCGAACTGAACTCGAGTTCAGTTCGCTCAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019713.2-541s1c1
Sequence:CCGGGCTATTAAGCATCTGCATGTTCTCGAGAACATGCAGATGCTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019713.2-879s1c1
Sequence:CCGGGTATTCTCGTTGTCGCCAGAACTCGAGTTCTGGCGACAACGAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019713.2-803s1c1
Sequence:CCGGGCATGCCTGAACTGCACAATTCTCGAGAATTGTGCAGTTCAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019713.3-334s21c1
Sequence:CCGGGACTACAATGGCCAGATCAACCTCGAGGTTGATCTGGCCATTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019713.3-403s21c1
Sequence:CCGGATCAAGGTTCAGCTGAAACTACTCGAGTAGTTTCAGCTGAACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019713.3-1088s21c1
Sequence:CCGGGCCGTCTACCTGTGGATATAGCTCGAGCTATATCCACAGGTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019713.3-360s21c1
Sequence:CCGGCCTCTTCATGAGCCTGAATAACTCGAGTTATTCAGGCTCATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019713.3-640s21c1
Sequence:CCGGGCACTCTTTGAGCGAACTGAACTCGAGTTCAGTTCGCTCAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019713
VALIDATED
RASSF1 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019713.2-628s1c1
Sequence:CCGGCCTCGCAAGTTTGCACTCTTTCTCGAGAAAGAGTGCAAACTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019713.2-640s1c1
Sequence:CCGGGCACTCTTTGAGCGAACTGAACTCGAGTTCAGTTCGCTCAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019713.2-541s1c1
Sequence:CCGGGCTATTAAGCATCTGCATGTTCTCGAGAACATGCAGATGCTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019713.2-879s1c1
Sequence:CCGGGTATTCTCGTTGTCGCCAGAACTCGAGTTCTGGCGACAACGAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019713.2-803s1c1
Sequence:CCGGGCATGCCTGAACTGCACAATTCTCGAGAATTGTGCAGTTCAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019713.3-334s21c1
Sequence:CCGGGACTACAATGGCCAGATCAACCTCGAGGTTGATCTGGCCATTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019713.3-403s21c1
Sequence:CCGGATCAAGGTTCAGCTGAAACTACTCGAGTAGTTTCAGCTGAACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019713.3-1088s21c1
Sequence:CCGGGCCGTCTACCTGTGGATATAGCTCGAGCTATATCCACAGGTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019713.3-360s21c1
Sequence:CCGGCCTCTTCATGAGCCTGAATAACTCGAGTTATTCAGGCTCATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019713.3-640s21c1
Sequence:CCGGGCACTCTTTGAGCGAACTGAACTCGAGTTCAGTTCGCTCAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019713
VALIDATED
RASSF1 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019713.2-628s1c1
Sequence:CCGGCCTCGCAAGTTTGCACTCTTTCTCGAGAAAGAGTGCAAACTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019713.2-640s1c1
Sequence:CCGGGCACTCTTTGAGCGAACTGAACTCGAGTTCAGTTCGCTCAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019713.2-541s1c1
Sequence:CCGGGCTATTAAGCATCTGCATGTTCTCGAGAACATGCAGATGCTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019713.2-879s1c1
Sequence:CCGGGTATTCTCGTTGTCGCCAGAACTCGAGTTCTGGCGACAACGAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019713.2-803s1c1
Sequence:CCGGGCATGCCTGAACTGCACAATTCTCGAGAATTGTGCAGTTCAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019713.3-334s21c1
Sequence:CCGGGACTACAATGGCCAGATCAACCTCGAGGTTGATCTGGCCATTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019713.3-403s21c1
Sequence:CCGGATCAAGGTTCAGCTGAAACTACTCGAGTAGTTTCAGCTGAACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019713.3-1088s21c1
Sequence:CCGGGCCGTCTACCTGTGGATATAGCTCGAGCTATATCCACAGGTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019713.3-360s21c1
Sequence:CCGGCCTCTTCATGAGCCTGAATAACTCGAGTTATTCAGGCTCATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019713.3-640s21c1
Sequence:CCGGGCACTCTTTGAGCGAACTGAACTCGAGTTCAGTTCGCTCAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks