EMAIL THIS PAGE TO A FRIEND

RASSF3

Ras association (RalGDS/AF-6) domain family member 3

Synonyms: RASSF5
UniProtKB ID: Q86WH2, Q86WH1
Gene ID:
Human(283349) Summary: The RAS oncogene (MIM 190020) is mutated in nearly one-third of all human cancers. Members of the RAS superfamily are plasma membrane GTP-binding proteins that modulate intracellular signal transduction pathways. A subfamily of RAS effectors, including RASSF3, share a RAS association (RA) domain.[supplied by OMIM, Jul 2003]
Mouse(192678) Ras association (RalGDS/AF-6) domain family member 3
Rat(362886) Ras association (RalGDS/AF-6) domain family member 3
chicken(417828) Ras association (RalGDS/AF-6) domain family member 3
domestic cat(101087934) Ras association (RalGDS/AF-6) domain family member 3
dog(608312) Ras association (RalGDS/AF-6) domain family member 3
naked mole-rat(101710748) Ras association (RalGDS/AF-6) domain family member 3
domestic guinea pig(100731404) Ras association (RalGDS/AF-6) domain family member 3
cow(536808) Ras association (RalGDS/AF-6) domain family member 3
sheep(101110579) Ras association (RalGDS/AF-6) domain family member 3
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178169 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178169 Rosetta Predictions human pricing
NM_001108747 Rosetta Predictions rat pricing
NM_138956 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169043 predicted 428
2 SASI_Hs01_00169044 predicted 328
3 SASI_Hs01_00169045 predicted 331
4 SASI_Hs01_00169046 predicted 534
5 SASI_Hs02_00369580 predicted 306
6 SASI_Hs02_00369581 predicted 456
7 SASI_Hs01_00169048 predicted 538
8 SASI_Hs01_00169049 predicted 818
9 SASI_Hs01_00169050 predicted 420
10 SASI_Hs01_00169051 predicted 384
11 SASI_Hs01_00169047 predicted 439
12 SASI_Hs01_00169052 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241685 predicted 558
2 SASI_Rn02_00241686 predicted 1092
3 SASI_Rn02_00241687 predicted 567
4 SASI_Rn02_00241688 predicted 391
5 SASI_Rn02_00241689 predicted 374
6 SASI_Rn02_00241690 predicted 477
7 SASI_Rn02_00241691 predicted 466
8 SASI_Rn02_00241692 predicted 1029
9 SASI_Rn02_00241693 predicted 490
10 SASI_Rn02_00241694 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138956 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339855 predicted 366
2 SASI_Mm02_00339856 predicted 510
3 SASI_Mm02_00339857 predicted 537
4 SASI_Mm02_00339858 predicted 1185
5 SASI_Mm01_00032171 predicted 1244
6 SASI_Mm01_00032172 predicted 932
7 SASI_Mm02_00339859 predicted 295
8 SASI_Mm01_00032174 predicted 857
9 SASI_Mm01_00032178 predicted 539
10 SASI_Mm02_00339860 predicted 969
11 SASI_Mm01_00032169 predicted 1169
12 SASI_Mm01_00032170 predicted 1241
13 SASI_Mm01_00032173 predicted 296
14 SASI_Mm01_00032175 predicted 1144
15 SASI_Mm01_00032176 predicted 464
16 SASI_Mm01_00032177 predicted 1056
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178169
VALIDATED
RASSF3 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-434s21c1
Sequence:CCGGGTAGCAATGGCTGTATGAATACTCGAGTATTCATACAGCCATTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-374s21c1
Sequence:CCGGTACAGATGGAACTCTGCAAACCTCGAGGTTTGCAGAGTTCCATCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-607s21c1
Sequence:CCGGCATCCACTCTACCTGCGTTTGCTCGAGCAAACGCAGGTAGAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-398s21c1
Sequence:CCGGCACAGACTTCTCCAAATTCTGCTCGAGCAGAATTTGGAGAAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-542s21c1
Sequence:CCGGTTGCACTTTATAAGCGTTGTCCTCGAGGACAACGCTTATAAAGTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-761s21c1
Sequence:CCGGAGAACCTGAAGAGGCGCTACACTCGAGTGTAGCGCCTCTTCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-308s21c1
Sequence:CCGGTAGCAGTCACAGACAAGTTGACTCGAGTCAACTTGTCTGTGACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_178169.2-946s1c1
Sequence:CCGGCGCCTTTCTATCTGTAGATTTCTCGAGAAATCTACAGATAGAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_178169.2-335s1c1
Sequence:CCGGCCTTGAATTCAAATGGGATTTCTCGAGAAATCCCATTTGAATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178169.2-222s1c1
Sequence:CCGGCGGCCAACAAGATGTTGAGAACTCGAGTTCTCAACATCTTGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_178169.2-277s1c1
Sequence:CCGGGAGATCAAAGAGAAAGTTCATCTCGAGATGAACTTTCTCTTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178169
VALIDATED
RASSF3 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-434s21c1
Sequence:CCGGGTAGCAATGGCTGTATGAATACTCGAGTATTCATACAGCCATTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-374s21c1
Sequence:CCGGTACAGATGGAACTCTGCAAACCTCGAGGTTTGCAGAGTTCCATCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-607s21c1
Sequence:CCGGCATCCACTCTACCTGCGTTTGCTCGAGCAAACGCAGGTAGAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-398s21c1
Sequence:CCGGCACAGACTTCTCCAAATTCTGCTCGAGCAGAATTTGGAGAAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-542s21c1
Sequence:CCGGTTGCACTTTATAAGCGTTGTCCTCGAGGACAACGCTTATAAAGTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-761s21c1
Sequence:CCGGAGAACCTGAAGAGGCGCTACACTCGAGTGTAGCGCCTCTTCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-308s21c1
Sequence:CCGGTAGCAGTCACAGACAAGTTGACTCGAGTCAACTTGTCTGTGACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_178169.2-946s1c1
Sequence:CCGGCGCCTTTCTATCTGTAGATTTCTCGAGAAATCTACAGATAGAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_178169.2-335s1c1
Sequence:CCGGCCTTGAATTCAAATGGGATTTCTCGAGAAATCCCATTTGAATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178169.2-222s1c1
Sequence:CCGGCGGCCAACAAGATGTTGAGAACTCGAGTTCTCAACATCTTGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_178169.2-277s1c1
Sequence:CCGGGAGATCAAAGAGAAAGTTCATCTCGAGATGAACTTTCTCTTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178169
VALIDATED
RASSF3 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-434s21c1
Sequence:CCGGGTAGCAATGGCTGTATGAATACTCGAGTATTCATACAGCCATTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-374s21c1
Sequence:CCGGTACAGATGGAACTCTGCAAACCTCGAGGTTTGCAGAGTTCCATCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-607s21c1
Sequence:CCGGCATCCACTCTACCTGCGTTTGCTCGAGCAAACGCAGGTAGAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-398s21c1
Sequence:CCGGCACAGACTTCTCCAAATTCTGCTCGAGCAGAATTTGGAGAAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-542s21c1
Sequence:CCGGTTGCACTTTATAAGCGTTGTCCTCGAGGACAACGCTTATAAAGTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-761s21c1
Sequence:CCGGAGAACCTGAAGAGGCGCTACACTCGAGTGTAGCGCCTCTTCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178169.2-308s21c1
Sequence:CCGGTAGCAGTCACAGACAAGTTGACTCGAGTCAACTTGTCTGTGACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_178169.2-946s1c1
Sequence:CCGGCGCCTTTCTATCTGTAGATTTCTCGAGAAATCTACAGATAGAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_178169.2-335s1c1
Sequence:CCGGCCTTGAATTCAAATGGGATTTCTCGAGAAATCCCATTTGAATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178169.2-222s1c1
Sequence:CCGGCGGCCAACAAGATGTTGAGAACTCGAGTTCTCAACATCTTGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_178169.2-277s1c1
Sequence:CCGGGAGATCAAAGAGAAAGTTCATCTCGAGATGAACTTTCTCTTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138956
VALIDATED
RASSF3 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138956.2-312s1c2
Sequence:CCGGCATAAATACAATTCAGCCGTTCTCGAGAACGGCTGAATTGTATTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-459s21c1
Sequence:CCGGCTTCACATCAGCAGTACAAACCTCGAGGTTTGTACTGCTGATGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-565s21c1
Sequence:CCGGACCGGGAAGACCAAGTGTATGCTCGAGCATACACTTGGTCTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138956.3-2425s21c1
Sequence:CCGGCCCAGCTCTTAGCCTTTCTATCTCGAGATAGAAAGGCTAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-377s21c1
Sequence:CCGGTGGCTTCATTAAGGTGCAGATCTCGAGATCTGCACCTTAATGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-260s21c1
Sequence:CCGGAGAGAAGGAAACGCACAATTACTCGAGTAATTGTGCGTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138956.2-377s1c1
Sequence:CCGGTGGCTTCATTAAGGTGCAGATCTCGAGATCTGCACCTTAATGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138956.2-260s1c1
Sequence:CCGGAGAGAAGGAAACGCACAATTACTCGAGTAATTGTGCGTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138956.2-534s1c1
Sequence:CCGGCCCACCAAGTTTGCGCTTTATCTCGAGATAAAGCGCAAACTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138956.2-2424s1c1
Sequence:CCGGCCCAGCTCTTAGCCTTTCTATCTCGAGATAGAAAGGCTAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138956
VALIDATED
RASSF3 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138956.2-312s1c2
Sequence:CCGGCATAAATACAATTCAGCCGTTCTCGAGAACGGCTGAATTGTATTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-459s21c1
Sequence:CCGGCTTCACATCAGCAGTACAAACCTCGAGGTTTGTACTGCTGATGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-565s21c1
Sequence:CCGGACCGGGAAGACCAAGTGTATGCTCGAGCATACACTTGGTCTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138956.3-2425s21c1
Sequence:CCGGCCCAGCTCTTAGCCTTTCTATCTCGAGATAGAAAGGCTAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-377s21c1
Sequence:CCGGTGGCTTCATTAAGGTGCAGATCTCGAGATCTGCACCTTAATGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-260s21c1
Sequence:CCGGAGAGAAGGAAACGCACAATTACTCGAGTAATTGTGCGTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138956.2-377s1c1
Sequence:CCGGTGGCTTCATTAAGGTGCAGATCTCGAGATCTGCACCTTAATGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138956.2-260s1c1
Sequence:CCGGAGAGAAGGAAACGCACAATTACTCGAGTAATTGTGCGTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138956.2-534s1c1
Sequence:CCGGCCCACCAAGTTTGCGCTTTATCTCGAGATAAAGCGCAAACTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138956.2-2424s1c1
Sequence:CCGGCCCAGCTCTTAGCCTTTCTATCTCGAGATAGAAAGGCTAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138956
VALIDATED
RASSF3 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138956.2-312s1c2
Sequence:CCGGCATAAATACAATTCAGCCGTTCTCGAGAACGGCTGAATTGTATTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-459s21c1
Sequence:CCGGCTTCACATCAGCAGTACAAACCTCGAGGTTTGTACTGCTGATGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-565s21c1
Sequence:CCGGACCGGGAAGACCAAGTGTATGCTCGAGCATACACTTGGTCTTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138956.3-2425s21c1
Sequence:CCGGCCCAGCTCTTAGCCTTTCTATCTCGAGATAGAAAGGCTAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-377s21c1
Sequence:CCGGTGGCTTCATTAAGGTGCAGATCTCGAGATCTGCACCTTAATGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138956.3-260s21c1
Sequence:CCGGAGAGAAGGAAACGCACAATTACTCGAGTAATTGTGCGTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138956.2-377s1c1
Sequence:CCGGTGGCTTCATTAAGGTGCAGATCTCGAGATCTGCACCTTAATGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138956.2-260s1c1
Sequence:CCGGAGAGAAGGAAACGCACAATTACTCGAGTAATTGTGCGTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138956.2-534s1c1
Sequence:CCGGCCCACCAAGTTTGCGCTTTATCTCGAGATAAAGCGCAAACTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138956.2-2424s1c1
Sequence:CCGGCCCAGCTCTTAGCCTTTCTATCTCGAGATAGAAAGGCTAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks