EMAIL THIS PAGE TO A FRIEND

RASSF4

Ras association (RalGDS/AF-6) domain family member 4

Synonyms: AD037
UniProtKB ID: Q9H2L5, Q86WH5, Q86WH6, Q86WH7, Q8N5A9, Q8TCK6
Gene ID:
Human(83937) Summary: The function of this gene has not yet been determined but may involve a role in tumor suppression. Alternative splicing of this gene results in several transcript variants; however, most of the variants have not been fully described. [provided by RefSeq, Jul 2008]
Mouse(213391) Ras association (RalGDS/AF-6) domain family member 4
Rat(362423) Ras association (RalGDS/AF-6) domain family member 4
cow(510549) Ras association (RalGDS/AF-6) domain family member 4
sheep(101120631) Ras association (RalGDS/AF-6) domain family member 4
domestic guinea pig(100724457) Ras association (RalGDS/AF-6) domain family member 4
naked mole-rat(101727852) Ras association (RalGDS/AF-6) domain family member 4
Zebrafish(494494) Ras association (RalGDS/AF-6) domain family member 4
domestic cat(101098746) Ras association (RalGDS/AF-6) domain family member 4
Horse(100049802) Ras association (RalGDS/AF-6) domain family member 4
dog(607383) Ras association (RalGDS/AF-6) domain family member 4
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032023 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032023 Rosetta Predictions human pricing
NM_001024275 Rosetta Predictions rat pricing
NM_178045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229549 predicted 683
2 SASI_Hs01_00229550 predicted 249
3 SASI_Hs01_00229552 predicted 628
4 SASI_Hs01_00229553 predicted 637
5 SASI_Hs02_00359208 predicted 679
6 SASI_Hs01_00229555 predicted 701
7 SASI_Hs01_00229556 predicted 791
8 SASI_Hs01_00229557 predicted 663
9 SASI_Hs01_00229558 predicted 1407
10 SASI_Hs02_00359209 predicted 1259
11 SASI_Hs01_00229551 predicted 1322
12 SASI_Hs01_00229554 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075460 predicted 492
2 SASI_Rn01_00075461 predicted 972
3 SASI_Rn01_00075462 predicted 1190
4 SASI_Rn01_00075463 predicted 876
5 SASI_Rn01_00075464 predicted 1279
6 SASI_Rn01_00075465 predicted 887
7 SASI_Rn01_00075466 predicted 1052
8 SASI_Rn01_00075467 predicted 690
9 SASI_Rn01_00075468 predicted 839
10 SASI_Rn01_00075469 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139787 predicted 1008
2 SASI_Mm01_00139788 predicted 907
3 SASI_Mm01_00139789 predicted 997
4 SASI_Mm01_00139790 predicted 915
5 SASI_Mm01_00139791 predicted 1199
6 SASI_Mm01_00139792 predicted 728
7 SASI_Mm01_00139793 predicted 1249
8 SASI_Mm01_00139794 predicted 1297
9 SASI_Mm01_00139795 predicted 196
10 SASI_Mm01_00139796 predicted 756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032023
RASSF4 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-632s1c1
Sequence:CCGGGTTCTCTATCAACGGCCACTTCTCGAGAAGTGGCCGTTGATAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-170s1c1
Sequence:CCGGCATCAGTGACAGCAAGTCCATCTCGAGATGGACTTGCTGTCACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-845s1c1
Sequence:CCGGGTACCCGCTGATTTCCAGAATCTCGAGATTCTGGAAATCAGCGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-788s21c1
Sequence:CCGGGTTCGCACTCTACATCGTTCACTCGAGTGAACGATGTAGAGTGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-685s21c1
Sequence:CCGGCCTATGGATCCGTGACCAATGCTCGAGCATTGGTCACGGATCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-656s21c1
Sequence:CCGGCAATCATAAGACCTCCGTGTTCTCGAGAACACGGAGGTCTTATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032023.3-1763s1c2
Sequence:CCGGGCTGCAAGAAACACGGTCATTCTCGAGAATGACCGTGTTTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-406s1c2
Sequence:CCGGGCTGCCCTCTAAAGGAGCCATCTCGAGATGGCTCCTTTAGAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032023.3-1414s21c1
Sequence:CCGGGCTTCATCTGCTTGCACATTGCTCGAGCAATGTGCAAGCAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-943s21c1
Sequence:CCGGTCGCTCAGTACATTAAGTTTGCTCGAGCAAACTTAATGTACTGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032023
RASSF4 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-632s1c1
Sequence:CCGGGTTCTCTATCAACGGCCACTTCTCGAGAAGTGGCCGTTGATAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-170s1c1
Sequence:CCGGCATCAGTGACAGCAAGTCCATCTCGAGATGGACTTGCTGTCACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-845s1c1
Sequence:CCGGGTACCCGCTGATTTCCAGAATCTCGAGATTCTGGAAATCAGCGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-788s21c1
Sequence:CCGGGTTCGCACTCTACATCGTTCACTCGAGTGAACGATGTAGAGTGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-685s21c1
Sequence:CCGGCCTATGGATCCGTGACCAATGCTCGAGCATTGGTCACGGATCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-656s21c1
Sequence:CCGGCAATCATAAGACCTCCGTGTTCTCGAGAACACGGAGGTCTTATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032023.3-1763s1c2
Sequence:CCGGGCTGCAAGAAACACGGTCATTCTCGAGAATGACCGTGTTTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-406s1c2
Sequence:CCGGGCTGCCCTCTAAAGGAGCCATCTCGAGATGGCTCCTTTAGAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032023.3-1414s21c1
Sequence:CCGGGCTTCATCTGCTTGCACATTGCTCGAGCAATGTGCAAGCAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-943s21c1
Sequence:CCGGTCGCTCAGTACATTAAGTTTGCTCGAGCAAACTTAATGTACTGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032023
RASSF4 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-632s1c1
Sequence:CCGGGTTCTCTATCAACGGCCACTTCTCGAGAAGTGGCCGTTGATAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-170s1c1
Sequence:CCGGCATCAGTGACAGCAAGTCCATCTCGAGATGGACTTGCTGTCACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-845s1c1
Sequence:CCGGGTACCCGCTGATTTCCAGAATCTCGAGATTCTGGAAATCAGCGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-788s21c1
Sequence:CCGGGTTCGCACTCTACATCGTTCACTCGAGTGAACGATGTAGAGTGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-685s21c1
Sequence:CCGGCCTATGGATCCGTGACCAATGCTCGAGCATTGGTCACGGATCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-656s21c1
Sequence:CCGGCAATCATAAGACCTCCGTGTTCTCGAGAACACGGAGGTCTTATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032023.3-1763s1c2
Sequence:CCGGGCTGCAAGAAACACGGTCATTCTCGAGAATGACCGTGTTTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032023.3-406s1c2
Sequence:CCGGGCTGCCCTCTAAAGGAGCCATCTCGAGATGGCTCCTTTAGAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032023.3-1414s21c1
Sequence:CCGGGCTTCATCTGCTTGCACATTGCTCGAGCAATGTGCAAGCAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032023.3-943s21c1
Sequence:CCGGTCGCTCAGTACATTAAGTTTGCTCGAGCAAACTTAATGTACTGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178045
RASSF4 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178045.3-1332s1c1
Sequence:CCGGGCCACATTGTATGGTTGATTACTCGAGTAATCAACCATACAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-722s1c1
Sequence:CCGGCTAAACAAGTTCCGGGTAGAACTCGAGTTCTACCCGGAACTTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-502s1c1
Sequence:CCGGCCCACAGCTTATGCGGACAAACTCGAGTTTGTCCGCATAAGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-915s1c1
Sequence:CCGGCCCAGTACATTAAGTTCGAAACTCGAGTTTCGAACTTAATGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-1012s1c2
Sequence:CCGGCCAAGCCTTGCGTCTAACAATCTCGAGATTGTTAGACGCAAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178045
RASSF4 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178045.3-1332s1c1
Sequence:CCGGGCCACATTGTATGGTTGATTACTCGAGTAATCAACCATACAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-722s1c1
Sequence:CCGGCTAAACAAGTTCCGGGTAGAACTCGAGTTCTACCCGGAACTTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-502s1c1
Sequence:CCGGCCCACAGCTTATGCGGACAAACTCGAGTTTGTCCGCATAAGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-915s1c1
Sequence:CCGGCCCAGTACATTAAGTTCGAAACTCGAGTTTCGAACTTAATGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-1012s1c2
Sequence:CCGGCCAAGCCTTGCGTCTAACAATCTCGAGATTGTTAGACGCAAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178045
RASSF4 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178045.3-1332s1c1
Sequence:CCGGGCCACATTGTATGGTTGATTACTCGAGTAATCAACCATACAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-722s1c1
Sequence:CCGGCTAAACAAGTTCCGGGTAGAACTCGAGTTCTACCCGGAACTTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-502s1c1
Sequence:CCGGCCCACAGCTTATGCGGACAAACTCGAGTTTGTCCGCATAAGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-915s1c1
Sequence:CCGGCCCAGTACATTAAGTTCGAAACTCGAGTTTCGAACTTAATGTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178045.3-1012s1c2
Sequence:CCGGCCAAGCCTTGCGTCTAACAATCTCGAGATTGTTAGACGCAAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks