EMAIL THIS PAGE TO A FRIEND

RB1CC1

RB1-inducible coiled-coil 1

Synonyms: CC1 FIP200
UniProtKB ID: Q8TDY2, Q86YR4, Q8WVU9, Q92601
Gene ID:
Human(9821) Summary: The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
Mouse(12421) RB1-inducible coiled-coil 1
Rat(312927) RB1-inducible coiled-coil 1
chicken(421116) RB1-inducible coiled-coil 1
domestic cat(101091994) RB1-inducible coiled-coil 1
Horse(100050327) RB1-inducible coiled-coil 1
dog(477876) RB1-inducible coiled-coil 1
domestic guinea pig(100717631) RB1-inducible coiled-coil 1
naked mole-rat(101696553) RB1-inducible coiled-coil 1
Domestic Rabbit(100351898) RB1-inducible coiled-coil 1
cow(539858) RB1-inducible coiled-coil 1
sheep(101113247) RB1-inducible coiled-coil 1
181 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014781 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083617 Rosetta Predictions human pricing
NM_014781 Rosetta Predictions human pricing
NM_001107901 Rosetta Predictions rat pricing
NM_009826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317151 predicted 787
2 SASI_Hs02_00317152 predicted 3723
3 SASI_Hs02_00317153 predicted 1290
4 SASI_Hs02_00317154 predicted 4278
5 SASI_Hs02_00317155 predicted 1099
6 SASI_Hs02_00317156 predicted 2570
7 SASI_Hs02_00317157 predicted 4869
8 SASI_Hs02_00317158 predicted 4510
9 SASI_Hs02_00317159 predicted 2878
10 SASI_Hs02_00317160 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192234 predicted 787
2 SASI_Hs01_00192235 predicted 3727
3 SASI_Hs01_00192236 predicted 1287
4 SASI_Hs02_00346278 predicted 4269
5 SASI_Hs02_00346279 predicted 1096
6 SASI_Hs01_00192237 predicted 2570
7 SASI_Hs01_00192239 predicted 4874
8 SASI_Hs01_00192240 predicted 4519
9 SASI_Hs01_00192243 predicted 2874
10 SASI_Hs02_00346280 predicted 2254
11 SASI_Hs01_00192238 predicted 3893
12 SASI_Hs01_00192241 predicted 4139
13 SASI_Hs01_00192242 predicted 4083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233395 predicted 1397
2 SASI_Rn02_00233396 predicted 918
3 SASI_Rn02_00233397 predicted 1044
4 SASI_Rn02_00233398 predicted 2696
5 SASI_Rn02_00233399 predicted 2468
6 SASI_Rn02_00233400 predicted 1453
7 SASI_Rn02_00233401 predicted 3566
8 SASI_Rn02_00233402 predicted 4164
9 SASI_Rn02_00233403 predicted 1765
10 SASI_Rn02_00233404 predicted 1855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196359 predicted 2328
2 SASI_Mm02_00317161 predicted 1561
3 SASI_Mm02_00317162 predicted 976
4 SASI_Mm02_00317163 predicted 3166
5 SASI_Mm02_00317164 predicted 4598
6 SASI_Mm02_00317165 predicted 2690
7 SASI_Mm01_00196364 predicted 4475
8 SASI_Mm02_00317166 predicted 510
9 SASI_Mm02_00317167 predicted 764
10 SASI_Mm01_00196368 predicted 1864
11 SASI_Mm01_00196360 predicted 3146
12 SASI_Mm01_00196361 predicted 4741
13 SASI_Mm01_00196362 predicted 2552
14 SASI_Mm01_00196363 predicted 1886
15 SASI_Mm01_00196365 predicted 1547
16 SASI_Mm01_00196366 predicted 2350
17 SASI_Mm01_00196367 predicted 1506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014781
VALIDATED
RB1CC1 MISSION shRNA Bacterial Glycerol Stock
RB1-inducible coiled-coil 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014781.4-5755s21c1
Sequence:CCGGGCACTCTTTAACACATTCTTTCTCGAGAAAGAATGTGTTAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-2881s21c1
Sequence:CCGGAGACGAATGCAGGATACAAATCTCGAGATTTGTATCCTGCATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-2792s21c1
Sequence:CCGGTGTCGTCTCCTAATCCTATAACTCGAGTTATAGGATTAGGAGACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-2761s21c1
Sequence:CCGGGCTGTGAATGAGTTTGTAATACTCGAGTATTACAAACTCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-1970s21c1
Sequence:CCGGCTTTGCTCCGCCTCGTAATAGCTCGAGCTATTACGAGGCGGAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014781.3-5721s1c1
Sequence:CCGGGCACTCTTTAACACATTCTTTCTCGAGAAAGAATGTGTTAAAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014781.3-2727s1c1
Sequence:CCGGGCTGTGAATGAGTTTGTAATACTCGAGTATTACAAACTCATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014781.3-1533s1c1
Sequence:CCGGCCAAGGATTATTCGACCATTTCTCGAGAAATGGTCGAATAATCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014781.3-5065s1c1
Sequence:CCGGGCCATGACAATTATGTGTTATCTCGAGATAACACATAATTGTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014781.3-1348s1c1
Sequence:CCGGGCAAAGAAATTAGGGAATCTTCTCGAGAAGATTCCCTAATTTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014781
VALIDATED
RB1CC1 MISSION shRNA shRNA Plasmid DNA
RB1-inducible coiled-coil 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014781.4-5755s21c1
Sequence:CCGGGCACTCTTTAACACATTCTTTCTCGAGAAAGAATGTGTTAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-2881s21c1
Sequence:CCGGAGACGAATGCAGGATACAAATCTCGAGATTTGTATCCTGCATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-2792s21c1
Sequence:CCGGTGTCGTCTCCTAATCCTATAACTCGAGTTATAGGATTAGGAGACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-2761s21c1
Sequence:CCGGGCTGTGAATGAGTTTGTAATACTCGAGTATTACAAACTCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-1970s21c1
Sequence:CCGGCTTTGCTCCGCCTCGTAATAGCTCGAGCTATTACGAGGCGGAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014781.3-5721s1c1
Sequence:CCGGGCACTCTTTAACACATTCTTTCTCGAGAAAGAATGTGTTAAAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014781.3-2727s1c1
Sequence:CCGGGCTGTGAATGAGTTTGTAATACTCGAGTATTACAAACTCATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014781.3-1533s1c1
Sequence:CCGGCCAAGGATTATTCGACCATTTCTCGAGAAATGGTCGAATAATCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014781.3-5065s1c1
Sequence:CCGGGCCATGACAATTATGTGTTATCTCGAGATAACACATAATTGTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014781.3-1348s1c1
Sequence:CCGGGCAAAGAAATTAGGGAATCTTCTCGAGAAGATTCCCTAATTTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014781
VALIDATED
RB1CC1 MISSION shRNA Lentiviral Transduction Particles
RB1-inducible coiled-coil 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014781.4-5755s21c1
Sequence:CCGGGCACTCTTTAACACATTCTTTCTCGAGAAAGAATGTGTTAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-2881s21c1
Sequence:CCGGAGACGAATGCAGGATACAAATCTCGAGATTTGTATCCTGCATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-2792s21c1
Sequence:CCGGTGTCGTCTCCTAATCCTATAACTCGAGTTATAGGATTAGGAGACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-2761s21c1
Sequence:CCGGGCTGTGAATGAGTTTGTAATACTCGAGTATTACAAACTCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014781.4-1970s21c1
Sequence:CCGGCTTTGCTCCGCCTCGTAATAGCTCGAGCTATTACGAGGCGGAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014781.3-5721s1c1
Sequence:CCGGGCACTCTTTAACACATTCTTTCTCGAGAAAGAATGTGTTAAAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014781.3-2727s1c1
Sequence:CCGGGCTGTGAATGAGTTTGTAATACTCGAGTATTACAAACTCATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014781.3-1533s1c1
Sequence:CCGGCCAAGGATTATTCGACCATTTCTCGAGAAATGGTCGAATAATCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014781.3-5065s1c1
Sequence:CCGGGCCATGACAATTATGTGTTATCTCGAGATAACACATAATTGTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014781.3-1348s1c1
Sequence:CCGGGCAAAGAAATTAGGGAATCTTCTCGAGAAGATTCCCTAATTTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009826
RB1CC1 MISSION shRNA Bacterial Glycerol Stock
RB1-inducible coiled-coil 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-3264s21c1
Sequence:CCGGGATAATGCATACTCAACATTGCTCGAGCAATGTTGAGTATGCATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-1867s21c1
Sequence:CCGGCGCCTTGTAATAGAGCTGTTACTCGAGTAACAGCTCTATTACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009826.4-5691s21c1
Sequence:CCGGATTGCATGCAGATAATCATAACTCGAGTTATGATTATCTGCATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-4964s21c1
Sequence:CCGGTAGATGAGCGGCACGACAATTCTCGAGAATTGTCGTGCCGCTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-4427s21c1
Sequence:CCGGCCAACTTTAACACAGTCTTAACTCGAGTTAAGACTGTGTTAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009826.3-5463s1c1
Sequence:CCGGCCACCCAAATAACTAGAAATTCTCGAGAATTTCTAGTTATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-1867s1c1
Sequence:CCGGCGCCTTGTAATAGAGCTGTTACTCGAGTAACAGCTCTATTACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-4427s1c1
Sequence:CCGGCCAACTTTAACACAGTCTTAACTCGAGTTAAGACTGTGTTAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-3370s1c1
Sequence:CCGGGCTGAATTTCAGTGCTTAGAACTCGAGTTCTAAGCACTGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-1455s1c1
Sequence:CCGGCCCAAAGATTATTCAACCATTCTCGAGAATGGTTGAATAATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009826
RB1CC1 MISSION shRNA shRNA Plasmid DNA
RB1-inducible coiled-coil 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-3264s21c1
Sequence:CCGGGATAATGCATACTCAACATTGCTCGAGCAATGTTGAGTATGCATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-1867s21c1
Sequence:CCGGCGCCTTGTAATAGAGCTGTTACTCGAGTAACAGCTCTATTACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009826.4-5691s21c1
Sequence:CCGGATTGCATGCAGATAATCATAACTCGAGTTATGATTATCTGCATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-4964s21c1
Sequence:CCGGTAGATGAGCGGCACGACAATTCTCGAGAATTGTCGTGCCGCTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-4427s21c1
Sequence:CCGGCCAACTTTAACACAGTCTTAACTCGAGTTAAGACTGTGTTAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009826.3-5463s1c1
Sequence:CCGGCCACCCAAATAACTAGAAATTCTCGAGAATTTCTAGTTATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-1867s1c1
Sequence:CCGGCGCCTTGTAATAGAGCTGTTACTCGAGTAACAGCTCTATTACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-4427s1c1
Sequence:CCGGCCAACTTTAACACAGTCTTAACTCGAGTTAAGACTGTGTTAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-3370s1c1
Sequence:CCGGGCTGAATTTCAGTGCTTAGAACTCGAGTTCTAAGCACTGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-1455s1c1
Sequence:CCGGCCCAAAGATTATTCAACCATTCTCGAGAATGGTTGAATAATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009826
RB1CC1 MISSION shRNA Lentiviral Transduction Particles
RB1-inducible coiled-coil 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-3264s21c1
Sequence:CCGGGATAATGCATACTCAACATTGCTCGAGCAATGTTGAGTATGCATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-1867s21c1
Sequence:CCGGCGCCTTGTAATAGAGCTGTTACTCGAGTAACAGCTCTATTACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009826.4-5691s21c1
Sequence:CCGGATTGCATGCAGATAATCATAACTCGAGTTATGATTATCTGCATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-4964s21c1
Sequence:CCGGTAGATGAGCGGCACGACAATTCTCGAGAATTGTCGTGCCGCTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009826.4-4427s21c1
Sequence:CCGGCCAACTTTAACACAGTCTTAACTCGAGTTAAGACTGTGTTAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009826.3-5463s1c1
Sequence:CCGGCCACCCAAATAACTAGAAATTCTCGAGAATTTCTAGTTATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-1867s1c1
Sequence:CCGGCGCCTTGTAATAGAGCTGTTACTCGAGTAACAGCTCTATTACAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-4427s1c1
Sequence:CCGGCCAACTTTAACACAGTCTTAACTCGAGTTAAGACTGTGTTAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-3370s1c1
Sequence:CCGGGCTGAATTTCAGTGCTTAGAACTCGAGTTCTAAGCACTGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009826.3-1455s1c1
Sequence:CCGGCCCAAAGATTATTCAACCATTCTCGAGAATGGTTGAATAATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks