EMAIL THIS PAGE TO A FRIEND

RBM15

RNA binding motif protein 15

Synonyms: OTT OTT1 SPEN
Gene ID:
Human(64783) Summary: Members of the SPEN (Split-end) family of proteins, including RBM15, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]
Mouse(229700) RNA binding motif protein 15
Rat(684233) RNA binding motif protein 15
Zebrafish(798517) RNA binding motif protein 15
Horse(100058541) RNA binding motif protein 15
domestic cat(101081997) RNA binding motif protein 15
dog(479909) RNA binding motif protein 15
chicken(419807) RNA binding motif protein 15
naked mole-rat(101715005) RNA binding motif protein 15
domestic guinea pig(100734769) RNA binding motif protein 15
cow(541044) RNA binding motif protein 15
sheep(101110718) RNA binding motif protein 15
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022768 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001045807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081591 MISSION® esiRNA esiRNA human RBM15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022768 Rosetta Predictions human pricing
XM_001068152 Rosetta Predictions rat pricing
NM_001045807 Rosetta Predictions mouse pricing
XM_131139 Rosetta Predictions mouse pricing
XM_900123 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219652 predicted 1233
2 SASI_Hs01_00219653 predicted 1192
3 SASI_Hs01_00219654 predicted 2644
4 SASI_Hs01_00219655 predicted 1543
5 SASI_Hs01_00219656 predicted 1310
6 SASI_Hs01_00219657 predicted 2605
7 SASI_Hs01_00219658 predicted 1552
8 SASI_Hs01_00219659 predicted 1271
9 SASI_Hs01_00219660 predicted 2553
10 SASI_Hs02_00356050 predicted 2735
11 SASI_Hs01_00219661 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323626 predicted 2756
2 SASI_Rn02_00323627 predicted 3903
3 SASI_Rn02_00323628 predicted 2205
4 SASI_Rn02_00323629 predicted 3335
5 SASI_Rn02_00323630 predicted 3459
6 SASI_Rn02_00323631 predicted 2068
7 SASI_Rn02_00323632 predicted 2741
8 SASI_Rn02_00323633 predicted 2397
9 SASI_Rn02_00323634 predicted 3858
10 SASI_Rn02_00323635 predicted 3359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291831 predicted 2240
2 SASI_Mm02_00291832 predicted 2019
3 SASI_Mm02_00291833 predicted 1653
4 SASI_Mm02_00291834 predicted 1722
5 SASI_Mm02_00291835 predicted 2680
6 SASI_Mm02_00291836 predicted 2736
7 SASI_Mm02_00291837 predicted 2027
8 SASI_Mm02_00291838 predicted 1627
9 SASI_Mm02_00291839 predicted 2639
10 SASI_Mm02_00291840 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277391 predicted 2627
2 SASI_Mm01_00277392 predicted 2408
3 SASI_Mm01_00277393 predicted 2038
4 SASI_Mm01_00277394 predicted 3069
5 SASI_Mm01_00277395 predicted 3123
6 SASI_Mm01_00277396 predicted 2186
7 SASI_Mm01_00277397 predicted 2426
8 SASI_Mm01_00277398 predicted 2018
9 SASI_Mm01_00277399 predicted 3531
10 SASI_Mm01_00277400 predicted 3023
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259788 predicted 2128
2 SASI_Mm01_00259789 predicted 1902
3 SASI_Mm01_00259790 predicted 1535
4 SASI_Mm01_00259791 predicted 2568
5 SASI_Mm01_00259792 predicted 2625
6 SASI_Mm01_00259793 predicted 1683
7 SASI_Mm01_00259794 predicted 1924
8 SASI_Mm01_00259795 predicted 1520
9 SASI_Mm01_00259796 predicted 2524
10 SASI_Mm01_00259797 predicted 819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022768
VALIDATED
RBM15 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 15
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_022768.4-581s1c1
Sequence:CCGGCGCGGAATACAAGACTCTGAACTCGAGTTCAGAGTCTTGTATTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022768.4-3152s1c1
Sequence:CCGGCCTCTGATGGAAGAAAGCTAACTCGAGTTAGCTTTCTTCCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022768.4-2643s1c1
Sequence:CCGGCCCAATGGTTATGCCATTCTTCTCGAGAAGAATGGCATAACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022768.4-2127s1c1
Sequence:CCGGGATCGTTACAACAGCGACAATCTCGAGATTGTCGCTGTTGTAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022768.4-1788s1c1
Sequence:CCGGCCACCCTTACTATACAGAGATCTCGAGATCTCTGTATAGTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022768.4-3067s21c1
Sequence:CCGGTTGAACAGCGGATGAAGATATCTCGAGATATCTTCATCCGCTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-2920s21c1
Sequence:CCGGATTACCTGGTCATGATCATTGCTCGAGCAATGATCATGACCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-441s21c1
Sequence:CCGGAGTAGCCGCTTGCATAGTTATCTCGAGATAACTATGCAAGCGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-1642s21c1
Sequence:CCGGGACGCCTTAGAGTAGACTTTGCTCGAGCAAAGTCTACTCTAAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022768.4-3019s21c1
Sequence:CCGGGGTTATAGTGGTGTCCCTAAACTCGAGTTTAGGGACACCACTATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-2748s21c1
Sequence:CCGGAGGAACCTTGTGTCCTATTTACTCGAGTAAATAGGACACAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-1547s21c1
Sequence:CCGGAGGTGATAGTTGGGCATATATCTCGAGATATATGCCCAACTATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-1497s21c1
Sequence:CCGGGCACGAGAATTTGATCGATTTCTCGAGAAATCGATCAAATTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022768
VALIDATED
RBM15 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 15
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_022768.4-581s1c1
Sequence:CCGGCGCGGAATACAAGACTCTGAACTCGAGTTCAGAGTCTTGTATTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022768.4-3152s1c1
Sequence:CCGGCCTCTGATGGAAGAAAGCTAACTCGAGTTAGCTTTCTTCCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022768.4-2643s1c1
Sequence:CCGGCCCAATGGTTATGCCATTCTTCTCGAGAAGAATGGCATAACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022768.4-2127s1c1
Sequence:CCGGGATCGTTACAACAGCGACAATCTCGAGATTGTCGCTGTTGTAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022768.4-1788s1c1
Sequence:CCGGCCACCCTTACTATACAGAGATCTCGAGATCTCTGTATAGTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022768.4-3067s21c1
Sequence:CCGGTTGAACAGCGGATGAAGATATCTCGAGATATCTTCATCCGCTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-2920s21c1
Sequence:CCGGATTACCTGGTCATGATCATTGCTCGAGCAATGATCATGACCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-441s21c1
Sequence:CCGGAGTAGCCGCTTGCATAGTTATCTCGAGATAACTATGCAAGCGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-1642s21c1
Sequence:CCGGGACGCCTTAGAGTAGACTTTGCTCGAGCAAAGTCTACTCTAAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022768.4-3019s21c1
Sequence:CCGGGGTTATAGTGGTGTCCCTAAACTCGAGTTTAGGGACACCACTATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-2748s21c1
Sequence:CCGGAGGAACCTTGTGTCCTATTTACTCGAGTAAATAGGACACAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-1547s21c1
Sequence:CCGGAGGTGATAGTTGGGCATATATCTCGAGATATATGCCCAACTATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-1497s21c1
Sequence:CCGGGCACGAGAATTTGATCGATTTCTCGAGAAATCGATCAAATTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022768
VALIDATED
RBM15 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 15
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_022768.4-581s1c1
Sequence:CCGGCGCGGAATACAAGACTCTGAACTCGAGTTCAGAGTCTTGTATTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022768.4-3152s1c1
Sequence:CCGGCCTCTGATGGAAGAAAGCTAACTCGAGTTAGCTTTCTTCCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022768.4-2643s1c1
Sequence:CCGGCCCAATGGTTATGCCATTCTTCTCGAGAAGAATGGCATAACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022768.4-2127s1c1
Sequence:CCGGGATCGTTACAACAGCGACAATCTCGAGATTGTCGCTGTTGTAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022768.4-1788s1c1
Sequence:CCGGCCACCCTTACTATACAGAGATCTCGAGATCTCTGTATAGTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022768.4-3067s21c1
Sequence:CCGGTTGAACAGCGGATGAAGATATCTCGAGATATCTTCATCCGCTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-2920s21c1
Sequence:CCGGATTACCTGGTCATGATCATTGCTCGAGCAATGATCATGACCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-441s21c1
Sequence:CCGGAGTAGCCGCTTGCATAGTTATCTCGAGATAACTATGCAAGCGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-1642s21c1
Sequence:CCGGGACGCCTTAGAGTAGACTTTGCTCGAGCAAAGTCTACTCTAAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022768.4-3019s21c1
Sequence:CCGGGGTTATAGTGGTGTCCCTAAACTCGAGTTTAGGGACACCACTATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-2748s21c1
Sequence:CCGGAGGAACCTTGTGTCCTATTTACTCGAGTAAATAGGACACAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-1547s21c1
Sequence:CCGGAGGTGATAGTTGGGCATATATCTCGAGATATATGCCCAACTATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022768.4-1497s21c1
Sequence:CCGGGCACGAGAATTTGATCGATTTCTCGAGAAATCGATCAAATTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045807
RBM15 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-1620s21c1
Sequence:CCGGGCACGAGAATTTGACCGATTTCTCGAGAAATCGGTCAAATTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-3049s21c1
Sequence:CCGGATTACCTGGTCATGATCATTGCTCGAGCAATGATCATGACCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-1670s21c1
Sequence:CCGGAGGTGACAGTTGGGCATATATCTCGAGATATATGCCCAACTGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-2352s21c1
Sequence:CCGGAGCGACAAGCGAGACCGTAAACTCGAGTTTACGGTCTCGCTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-2877s21c1
Sequence:CCGGAGGAACCTTGTGTCCTATTTACTCGAGTAAATAGGACACAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045807
RBM15 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-1620s21c1
Sequence:CCGGGCACGAGAATTTGACCGATTTCTCGAGAAATCGGTCAAATTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-3049s21c1
Sequence:CCGGATTACCTGGTCATGATCATTGCTCGAGCAATGATCATGACCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-1670s21c1
Sequence:CCGGAGGTGACAGTTGGGCATATATCTCGAGATATATGCCCAACTGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-2352s21c1
Sequence:CCGGAGCGACAAGCGAGACCGTAAACTCGAGTTTACGGTCTCGCTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-2877s21c1
Sequence:CCGGAGGAACCTTGTGTCCTATTTACTCGAGTAAATAGGACACAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045807
RBM15 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-1620s21c1
Sequence:CCGGGCACGAGAATTTGACCGATTTCTCGAGAAATCGGTCAAATTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-3049s21c1
Sequence:CCGGATTACCTGGTCATGATCATTGCTCGAGCAATGATCATGACCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-1670s21c1
Sequence:CCGGAGGTGACAGTTGGGCATATATCTCGAGATATATGCCCAACTGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-2352s21c1
Sequence:CCGGAGCGACAAGCGAGACCGTAAACTCGAGTTTACGGTCTCGCTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045807.1-2877s21c1
Sequence:CCGGAGGAACCTTGTGTCCTATTTACTCGAGTAAATAGGACACAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks