EMAIL THIS PAGE TO A FRIEND

RBM43

RNA binding motif protein 43

Synonyms: C2orf38
UniProtKB ID: Q6ZSC3, B2RMT5
Gene ID:
Mouse(71684) RNA binding motif protein 43
Rat(311020) RNA binding motif protein 43
chicken(424313) RNA binding motif protein 43
domestic cat(101086166) RNA binding motif protein 43
domestic guinea pig(100729030) RNA binding motif protein 43
naked mole-rat(101717303) RNA binding motif protein 43
cow(617625) RNA binding motif protein 43
sheep(101119882) RNA binding motif protein 43
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198557 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198557 Rosetta Predictions human pricing
NM_001037649 Rosetta Predictions rat pricing
NM_030243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133030 predicted 829
2 SASI_Hs01_00133031 predicted 836
3 SASI_Hs01_00133033 predicted 863
4 SASI_Hs01_00133034 predicted 976
5 SASI_Hs01_00133035 predicted 983
6 SASI_Hs01_00133036 predicted 743
7 SASI_Hs01_00133037 predicted 797
8 SASI_Hs01_00133038 predicted 759
9 SASI_Hs01_00133039 predicted 889
10 SASI_Hs02_00372172 predicted 923
11 SASI_Hs01_00133032 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204521 predicted 470
2 SASI_Rn01_00106187 predicted 1594
3 SASI_Rn01_00106188 predicted 961
4 SASI_Rn01_00106189 predicted 758
5 SASI_Rn01_00106190 predicted 594
6 SASI_Rn01_00106191 predicted 473
7 SASI_Rn01_00106192 predicted 964
8 SASI_Rn01_00106193 predicted 589
9 SASI_Rn01_00106194 predicted 1640
10 SASI_Rn01_00106195 predicted 1476
11 SASI_Rn01_00106196 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140657 predicted 560
2 SASI_Mm02_00336707 predicted 1027
3 SASI_Mm01_00140658 predicted 1418
4 SASI_Mm01_00140660 predicted 532
5 SASI_Mm02_00336708 predicted 1233
6 SASI_Mm01_00140661 predicted 1008
7 SASI_Mm01_00140662 predicted 363
8 SASI_Mm01_00140663 predicted 1445
9 SASI_Mm01_00140664 predicted 910
10 SASI_Mm01_00140665 predicted 626
11 SASI_Mm01_00140659 predicted 1295
12 SASI_Mm01_00140666 predicted 1428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198557
RBM43 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 43
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198557.1-235s1c1
Sequence:CCGGCCGTATTAGTGAAGAGCCACTCTCGAGAGTGGCTCTTCACTAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198557.1-171s1c1
Sequence:CCGGGCTCCTGAAAGAACGGTTGTACTCGAGTACAACCGTTCTTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198557.1-1257s1c1
Sequence:CCGGGCAGTGACCATTGCCATGAATCTCGAGATTCATGGCAATGGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198557.1-236s1c1
Sequence:CCGGCGTATTAGTGAAGAGCCACTTCTCGAGAAGTGGCTCTTCACTAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198557.1-354s1c1
Sequence:CCGGGCAGAGAATGTCATCAGACAACTCGAGTTGTCTGATGACATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198557.1-2327s1c1
Sequence:CCGGGCTGTAACTCTAGGACTAATTCTCGAGAATTAGTCCTAGAGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198557.2-293s21c1
Sequence:CCGGGATGTTGAAGATGTGATATATCTCGAGATATATCACATCTTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198557.2-1088s21c1
Sequence:CCGGGAACAATTAAGTTCGAGATACCTCGAGGTATCTCGAACTTAATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198557.2-596s21c1
Sequence:CCGGATCTCCGTGGAAGGATCATTTCTCGAGAAATGATCCTTCCACGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198557
RBM43 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 43
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198557.1-235s1c1
Sequence:CCGGCCGTATTAGTGAAGAGCCACTCTCGAGAGTGGCTCTTCACTAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198557.1-171s1c1
Sequence:CCGGGCTCCTGAAAGAACGGTTGTACTCGAGTACAACCGTTCTTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198557.1-1257s1c1
Sequence:CCGGGCAGTGACCATTGCCATGAATCTCGAGATTCATGGCAATGGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198557.1-236s1c1
Sequence:CCGGCGTATTAGTGAAGAGCCACTTCTCGAGAAGTGGCTCTTCACTAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198557.1-354s1c1
Sequence:CCGGGCAGAGAATGTCATCAGACAACTCGAGTTGTCTGATGACATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198557.1-2327s1c1
Sequence:CCGGGCTGTAACTCTAGGACTAATTCTCGAGAATTAGTCCTAGAGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198557.2-293s21c1
Sequence:CCGGGATGTTGAAGATGTGATATATCTCGAGATATATCACATCTTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198557.2-1088s21c1
Sequence:CCGGGAACAATTAAGTTCGAGATACCTCGAGGTATCTCGAACTTAATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198557.2-596s21c1
Sequence:CCGGATCTCCGTGGAAGGATCATTTCTCGAGAAATGATCCTTCCACGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198557
RBM43 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 43
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198557.1-235s1c1
Sequence:CCGGCCGTATTAGTGAAGAGCCACTCTCGAGAGTGGCTCTTCACTAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198557.1-171s1c1
Sequence:CCGGGCTCCTGAAAGAACGGTTGTACTCGAGTACAACCGTTCTTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198557.1-1257s1c1
Sequence:CCGGGCAGTGACCATTGCCATGAATCTCGAGATTCATGGCAATGGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198557.1-236s1c1
Sequence:CCGGCGTATTAGTGAAGAGCCACTTCTCGAGAAGTGGCTCTTCACTAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198557.1-354s1c1
Sequence:CCGGGCAGAGAATGTCATCAGACAACTCGAGTTGTCTGATGACATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152681    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198557.1-2327s1c1
Sequence:CCGGGCTGTAACTCTAGGACTAATTCTCGAGAATTAGTCCTAGAGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198557.2-293s21c1
Sequence:CCGGGATGTTGAAGATGTGATATATCTCGAGATATATCACATCTTCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198557.2-1088s21c1
Sequence:CCGGGAACAATTAAGTTCGAGATACCTCGAGGTATCTCGAACTTAATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198557.2-596s21c1
Sequence:CCGGATCTCCGTGGAAGGATCATTTCTCGAGAAATGATCCTTCCACGGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030243
RBM43 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 43
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030243.2-501s1c1
Sequence:CCGGCCAAAGGAGTTGCGTATATCACTCGAGTGATATACGCAACTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030243.2-663s1c1
Sequence:CCGGGCACTCAAATTGAGCTAGAAACTCGAGTTTCTAGCTCAATTTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030243.2-1421s1c1
Sequence:CCGGCCCATCTAAGGTATAGGAGAACTCGAGTTCTCCTATACCTTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030243.2-512s1c1
Sequence:CCGGGCGTATATCATCTTCAAGGAACTCGAGTTCCTTGAAGATGATATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030243.4-347s21c1
Sequence:CCGGCCAAAGGAGTTGCGTATATCACTCGAGTGATATACGCAACTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030243.4-358s21c1
Sequence:CCGGGCGTATATCATCTTCAAGGAACTCGAGTTCCTTGAAGATGATATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030243.4-1267s21c1
Sequence:CCGGCCCATCTAAGGTATAGGAGAACTCGAGTTCTCCTATACCTTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030243.4-509s21c1
Sequence:CCGGGCACTCAAATTGAGCTAGAAACTCGAGTTTCTAGCTCAATTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030243
RBM43 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 43
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030243.2-501s1c1
Sequence:CCGGCCAAAGGAGTTGCGTATATCACTCGAGTGATATACGCAACTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030243.2-663s1c1
Sequence:CCGGGCACTCAAATTGAGCTAGAAACTCGAGTTTCTAGCTCAATTTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030243.2-1421s1c1
Sequence:CCGGCCCATCTAAGGTATAGGAGAACTCGAGTTCTCCTATACCTTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030243.2-512s1c1
Sequence:CCGGGCGTATATCATCTTCAAGGAACTCGAGTTCCTTGAAGATGATATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030243.4-347s21c1
Sequence:CCGGCCAAAGGAGTTGCGTATATCACTCGAGTGATATACGCAACTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030243.4-358s21c1
Sequence:CCGGGCGTATATCATCTTCAAGGAACTCGAGTTCCTTGAAGATGATATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030243.4-1267s21c1
Sequence:CCGGCCCATCTAAGGTATAGGAGAACTCGAGTTCTCCTATACCTTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030243.4-509s21c1
Sequence:CCGGGCACTCAAATTGAGCTAGAAACTCGAGTTTCTAGCTCAATTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030243
RBM43 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 43
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030243.2-501s1c1
Sequence:CCGGCCAAAGGAGTTGCGTATATCACTCGAGTGATATACGCAACTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030243.2-663s1c1
Sequence:CCGGGCACTCAAATTGAGCTAGAAACTCGAGTTTCTAGCTCAATTTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030243.2-1421s1c1
Sequence:CCGGCCCATCTAAGGTATAGGAGAACTCGAGTTCTCCTATACCTTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030243.2-512s1c1
Sequence:CCGGGCGTATATCATCTTCAAGGAACTCGAGTTCCTTGAAGATGATATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030243.4-347s21c1
Sequence:CCGGCCAAAGGAGTTGCGTATATCACTCGAGTGATATACGCAACTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030243.4-358s21c1
Sequence:CCGGGCGTATATCATCTTCAAGGAACTCGAGTTCCTTGAAGATGATATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030243.4-1267s21c1
Sequence:CCGGCCCATCTAAGGTATAGGAGAACTCGAGTTCTCCTATACCTTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030243.4-509s21c1
Sequence:CCGGGCACTCAAATTGAGCTAGAAACTCGAGTTTCTAGCTCAATTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks