EMAIL THIS PAGE TO A FRIEND

RBM46

RNA binding motif protein 46

Synonyms: CT68
UniProtKB ID: Q8TBY0
Gene ID:
Mouse(633285) RNA binding motif protein 46
Rat(310548) RNA binding motif protein 46
Zebrafish(566042) RNA binding motif protein 46
chicken(422404) RNA binding motif protein 46
Horse(100069685) RNA binding motif protein 46
domestic cat(101092179) RNA binding motif protein 46
dog(475475) RNA binding motif protein 46
cow(532175) RNA binding motif protein 46
sheep(101123151) RNA binding motif protein 46
naked mole-rat(101725265) RNA binding motif protein 46
domestic guinea pig(100723957) RNA binding motif protein 46
199 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41134 Anti-MGC27016 antibody produced in rabbit affinity isolated antibody rat, horse, rabbit, canine, human, bovine, mouse, zebrafish, guinea pig
immunohistochemistry, western blot pricing
HPA050601 Anti-RBM46 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144979 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144979 Rosetta Predictions human pricing
XM_001064630 Rosetta Predictions rat pricing
XM_227311 Rosetta Predictions rat pricing
XM_001477059 Rosetta Predictions mouse pricing
XM_907666 Rosetta Predictions mouse pricing
XM_993319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226590 predicted 896
2 SASI_Hs01_00226591 predicted 896
3 SASI_Hs01_00226592 predicted 1271
4 SASI_Hs01_00226593 predicted 793
5 SASI_Hs01_00226594 predicted 364
6 SASI_Hs01_00226595 predicted 471
7 SASI_Hs01_00226596 predicted 1727
8 SASI_Hs01_00226597 predicted 494
9 SASI_Hs01_00226598 predicted 975
10 SASI_Hs02_00364783 predicted 1427
11 SASI_Hs01_00226589 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311252 predicted 881
2 SASI_Rn02_00311253 predicted 597
3 SASI_Rn02_00311254 predicted 991
4 SASI_Rn02_00311255 predicted 1269
5 SASI_Rn02_00311256 predicted 978
6 SASI_Rn02_00311257 predicted 1040
7 SASI_Rn02_00311258 predicted 484
8 SASI_Rn02_00311259 predicted 1068
9 SASI_Rn02_00311260 predicted 865
10 SASI_Rn02_00311261 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384227 predicted 881
2 SASI_Rn02_00384228 predicted 596
3 SASI_Rn02_00384229 predicted 995
4 SASI_Rn02_00384230 predicted 977
5 SASI_Rn02_00384231 predicted 1037
6 SASI_Rn02_00384232 predicted 569
7 SASI_Rn02_00384233 predicted 487
8 SASI_Rn02_00384234 predicted 1063
9 SASI_Rn02_00384235 predicted 659
10 SASI_Rn02_00384236 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00393185 predicted 1445
2 SASI_Mm02_00393186 predicted 999
3 SASI_Mm02_00393187 predicted 878
4 SASI_Mm02_00393188 predicted 596
5 SASI_Mm02_00393189 predicted 1474
6 SASI_Mm02_00393190 predicted 550
7 SASI_Mm02_00393191 predicted 524
8 SASI_Mm02_00393192 predicted 256
9 SASI_Mm02_00393193 predicted 1063
10 SASI_Mm02_00393194 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433479 predicted 1445
2 SASI_Mm02_00433480 predicted 993
3 SASI_Mm02_00433481 predicted 880
4 SASI_Mm02_00433482 predicted 599
5 SASI_Mm02_00433483 predicted 1470
6 SASI_Mm02_00433484 predicted 557
7 SASI_Mm02_00433485 predicted 522
8 SASI_Mm02_00433486 predicted 249
9 SASI_Mm02_00433487 predicted 1062
10 SASI_Mm02_00433488 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242608 predicted 368
2 SASI_Mm01_00242609 predicted 219
3 SASI_Mm01_00242610 predicted 353
4 SASI_Mm01_00242611 predicted 373
5 SASI_Mm01_00242612 predicted 214
6 SASI_Mm01_00242613 predicted 221
7 SASI_Mm01_00242614 predicted 348
8 SASI_Mm01_00242615 predicted 275
9 SASI_Mm01_00242616 predicted 344
10 SASI_Mm01_00242617 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144979
RBM46 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 46
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-1185s1c1
Sequence:CCGGCGCCTGAAGTTGAAAGATGCACTCGAGTGCATCTTTCAACTTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-170s1c1
Sequence:CCGGGCATTACTTGCTTTGATGGAACTCGAGTTCCATCAAAGCAAGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-995s1c1
Sequence:CCGGGCAAGTATTGAGGTAACACTACTCGAGTAGTGTTACCTCAATACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144979.2-158s1c1
Sequence:CCGGCAGAATGAAGCAGCATTACTTCTCGAGAAGTAATGCTGCTTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144979.2-1049s1c1
Sequence:CCGGCAGCATCTTAATGGTCAGATTCTCGAGAATCTGACCATTAAGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-1598s1c1
Sequence:CCGGCCTTATTCTTATCCAGGCTATCTCGAGATAGCCTGGATAAGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144979.2-320s1c1
Sequence:CCGGGAAGATGAGTTAGTTCCTGTACTCGAGTACAGGAACTAACTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134874    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144979.2-2135s1c1
Sequence:CCGGCCAGAAGCATCTAACCATTATCTCGAGATAATGGTTAGATGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144979.2-1968s1c1
Sequence:CCGGCTACTTTCTGAGTGGGCAATACTCGAGTATTGCCCACTCAGAAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144979.2-1913s1c1
Sequence:CCGGCTCTTGATAAAGGTACAGCAACTCGAGTTGCTGTACCTTTATCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144979
RBM46 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 46
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-1185s1c1
Sequence:CCGGCGCCTGAAGTTGAAAGATGCACTCGAGTGCATCTTTCAACTTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-170s1c1
Sequence:CCGGGCATTACTTGCTTTGATGGAACTCGAGTTCCATCAAAGCAAGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-995s1c1
Sequence:CCGGGCAAGTATTGAGGTAACACTACTCGAGTAGTGTTACCTCAATACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144979.2-158s1c1
Sequence:CCGGCAGAATGAAGCAGCATTACTTCTCGAGAAGTAATGCTGCTTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144979.2-1049s1c1
Sequence:CCGGCAGCATCTTAATGGTCAGATTCTCGAGAATCTGACCATTAAGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-1598s1c1
Sequence:CCGGCCTTATTCTTATCCAGGCTATCTCGAGATAGCCTGGATAAGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144979.2-320s1c1
Sequence:CCGGGAAGATGAGTTAGTTCCTGTACTCGAGTACAGGAACTAACTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134874    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144979.2-2135s1c1
Sequence:CCGGCCAGAAGCATCTAACCATTATCTCGAGATAATGGTTAGATGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144979.2-1968s1c1
Sequence:CCGGCTACTTTCTGAGTGGGCAATACTCGAGTATTGCCCACTCAGAAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144979.2-1913s1c1
Sequence:CCGGCTCTTGATAAAGGTACAGCAACTCGAGTTGCTGTACCTTTATCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144979
RBM46 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 46
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-1185s1c1
Sequence:CCGGCGCCTGAAGTTGAAAGATGCACTCGAGTGCATCTTTCAACTTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-170s1c1
Sequence:CCGGGCATTACTTGCTTTGATGGAACTCGAGTTCCATCAAAGCAAGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-995s1c1
Sequence:CCGGGCAAGTATTGAGGTAACACTACTCGAGTAGTGTTACCTCAATACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144979.2-158s1c1
Sequence:CCGGCAGAATGAAGCAGCATTACTTCTCGAGAAGTAATGCTGCTTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144979.2-1049s1c1
Sequence:CCGGCAGCATCTTAATGGTCAGATTCTCGAGAATCTGACCATTAAGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144979.2-1598s1c1
Sequence:CCGGCCTTATTCTTATCCAGGCTATCTCGAGATAGCCTGGATAAGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144979.2-320s1c1
Sequence:CCGGGAAGATGAGTTAGTTCCTGTACTCGAGTACAGGAACTAACTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134874    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144979.2-2135s1c1
Sequence:CCGGCCAGAAGCATCTAACCATTATCTCGAGATAATGGTTAGATGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144979.2-1968s1c1
Sequence:CCGGCTACTTTCTGAGTGGGCAATACTCGAGTATTGCCCACTCAGAAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144979.2-1913s1c1
Sequence:CCGGCTCTTGATAAAGGTACAGCAACTCGAGTTGCTGTACCTTTATCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks