EMAIL THIS PAGE TO A FRIEND

RBM4

RNA binding motif protein 4

Synonyms: LARK RBM4A ZCCHC21 ZCRB3A
Gene ID:
Mouse(19653) RNA binding motif protein 4
Rat(293663) RNA binding motif protein 4
Horse(100058690) RNA binding motif protein 4
dog(610648) RNA binding motif protein 4
domestic cat(101088520) RNA binding motif protein 4
cow(767937) RNA binding motif protein 4
Goat(100861126) RNA binding motif protein 4
sheep(101117121) RNA binding motif protein 4
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002896 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002896 Rosetta Predictions human pricing
XM_215201 Rosetta Predictions rat pricing
NM_009032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095514 predicted 648
2 SASI_Hs01_00095515 predicted 684
3 SASI_Hs01_00095516 predicted 640
4 SASI_Hs01_00095517 predicted 684
5 SASI_Hs01_00095519 predicted 654
6 SASI_Hs01_00095520 predicted 608
7 SASI_Hs02_00334701 predicted 680
8 SASI_Hs01_00095521 predicted 609
9 SASI_Hs01_00095522 predicted 608
10 SASI_Hs01_00095523 predicted 652
11 SASI_Hs01_00095518 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375855 predicted 946
2 SASI_Rn02_00375856 predicted 1013
3 SASI_Rn02_00375857 predicted 1014
4 SASI_Rn02_00375858 predicted 1601
5 SASI_Rn02_00375859 predicted 452
6 SASI_Rn02_00375860 predicted 947
7 SASI_Rn02_00375861 predicted 1027
8 SASI_Rn02_00375862 predicted 1569
9 SASI_Rn02_00375863 predicted 228
10 SASI_Rn02_00375864 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059120 predicted 766
2 SASI_Mm01_00059121 predicted 697
3 SASI_Mm01_00059122 predicted 759
4 SASI_Mm01_00059126 predicted 724
5 SASI_Mm01_00059127 predicted 727
6 SASI_Mm01_00059128 predicted 779
7 SASI_Mm01_00059129 predicted 1228
8 SASI_Mm02_00315187 predicted 774
9 SASI_Mm02_00315188 predicted 1087
10 SASI_Mm01_00059123 predicted 303
11 SASI_Mm01_00059124 predicted 1249
12 SASI_Mm01_00059125 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002896
VALIDATED
RBM4 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002896.2-384s21c1
Sequence:CCGGGCCAAGTTTGAGGAGTATGGTCTCGAGACCATACTCCTCAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002896.2-1388s21c1
Sequence:CCGGCCTGTTCTTCTGTCCTTCAATCTCGAGATTGAAGGACAGAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002896.2-806s21c1
Sequence:CCGGTGCAGCTGCCTCCGTGTATAACTCGAGTTATACACGGAGGCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002896.2-648s21c1
Sequence:CCGGGCAGACTTGACCGAGCAATATCTCGAGATATTGCTCGGTCAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002896.2-353s21c1
Sequence:CCGGCAGTCCCACCTGCACCAATAACTCGAGTTATTGGTGCAGGTGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002896.1-341s1c1
Sequence:CCGGGCCAAGTTTGAGGAGTATGGTCTCGAGACCATACTCCTCAAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002896.1-774s1c1
Sequence:CCGGCGTGTATAATTACGCAGAGCACTCGAGTGCTCTGCGTAATTATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002896.1-1344s1c1
Sequence:CCGGCCTGTTCTTCTGTCCTTCAATCTCGAGATTGAAGGACAGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002896.1-288s1c1
Sequence:CCGGCAAAGTTGCATGTGGGCAACACTCGAGTGTTGCCCACATGCAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002896.1-446s1c1
Sequence:CCGGCTTGATAACACAGAGTTTCAACTCGAGTTGAAACTCTGTGTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002896.1-139s1c1
Sequence:CCGGGCTGGAATGTGACATCATTAACTCGAGTTAATGATGTCACATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002896.1-1275s1c1
Sequence:CCGGGACCTTAATTTACCTTGCTAACTCGAGTTAGCAAGGTAAATTAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002896
VALIDATED
RBM4 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002896.2-384s21c1
Sequence:CCGGGCCAAGTTTGAGGAGTATGGTCTCGAGACCATACTCCTCAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002896.2-1388s21c1
Sequence:CCGGCCTGTTCTTCTGTCCTTCAATCTCGAGATTGAAGGACAGAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002896.2-806s21c1
Sequence:CCGGTGCAGCTGCCTCCGTGTATAACTCGAGTTATACACGGAGGCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002896.2-648s21c1
Sequence:CCGGGCAGACTTGACCGAGCAATATCTCGAGATATTGCTCGGTCAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002896.2-353s21c1
Sequence:CCGGCAGTCCCACCTGCACCAATAACTCGAGTTATTGGTGCAGGTGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002896.1-341s1c1
Sequence:CCGGGCCAAGTTTGAGGAGTATGGTCTCGAGACCATACTCCTCAAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002896.1-774s1c1
Sequence:CCGGCGTGTATAATTACGCAGAGCACTCGAGTGCTCTGCGTAATTATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002896.1-1344s1c1
Sequence:CCGGCCTGTTCTTCTGTCCTTCAATCTCGAGATTGAAGGACAGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002896.1-288s1c1
Sequence:CCGGCAAAGTTGCATGTGGGCAACACTCGAGTGTTGCCCACATGCAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002896.1-446s1c1
Sequence:CCGGCTTGATAACACAGAGTTTCAACTCGAGTTGAAACTCTGTGTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002896.1-139s1c1
Sequence:CCGGGCTGGAATGTGACATCATTAACTCGAGTTAATGATGTCACATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002896.1-1275s1c1
Sequence:CCGGGACCTTAATTTACCTTGCTAACTCGAGTTAGCAAGGTAAATTAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002896
VALIDATED
RBM4 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002896.2-384s21c1
Sequence:CCGGGCCAAGTTTGAGGAGTATGGTCTCGAGACCATACTCCTCAAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002896.2-1388s21c1
Sequence:CCGGCCTGTTCTTCTGTCCTTCAATCTCGAGATTGAAGGACAGAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002896.2-806s21c1
Sequence:CCGGTGCAGCTGCCTCCGTGTATAACTCGAGTTATACACGGAGGCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_002896.2-648s21c1
Sequence:CCGGGCAGACTTGACCGAGCAATATCTCGAGATATTGCTCGGTCAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002896.2-353s21c1
Sequence:CCGGCAGTCCCACCTGCACCAATAACTCGAGTTATTGGTGCAGGTGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002896.1-341s1c1
Sequence:CCGGGCCAAGTTTGAGGAGTATGGTCTCGAGACCATACTCCTCAAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002896.1-774s1c1
Sequence:CCGGCGTGTATAATTACGCAGAGCACTCGAGTGCTCTGCGTAATTATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002896.1-1344s1c1
Sequence:CCGGCCTGTTCTTCTGTCCTTCAATCTCGAGATTGAAGGACAGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002896.1-288s1c1
Sequence:CCGGCAAAGTTGCATGTGGGCAACACTCGAGTGTTGCCCACATGCAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002896.1-446s1c1
Sequence:CCGGCTTGATAACACAGAGTTTCAACTCGAGTTGAAACTCTGTGTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002896.1-139s1c1
Sequence:CCGGGCTGGAATGTGACATCATTAACTCGAGTTAATGATGTCACATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002896.1-1275s1c1
Sequence:CCGGGACCTTAATTTACCTTGCTAACTCGAGTTAGCAAGGTAAATTAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009032
VALIDATED
RBM4 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009032.2-2205s21c1
Sequence:CCGGCATGATGCACTTCACTATTTACTCGAGTAAATAGTGAAGTGCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009032.2-929s21c1
Sequence:CCGGGCTGCCTCTGCGTATAGTAACCTCGAGGTTACTATACGCAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009032.2-1099s21c1
Sequence:CCGGTGCAGCTTCTACTTCATATTACTCGAGTAATATGAAGTAGAAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009032.2-1020s21c1
Sequence:CCGGCCTCTCTCGATCCCTACAATACTCGAGTATTGTAGGGATCGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009032.2-812s21c1
Sequence:CCGGACGCCTTACACCATGAGTTATCTCGAGATAACTCATGGTGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009032.1-1304s1c1
Sequence:CCGGCCTTGTTAAGTTCTTTCTCTTCTCGAGAAGAGAAAGAACTTAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-871s1c1
Sequence:CCGGCCTCTCTTGATCCCTACAATACTCGAGTATTGTAGGGATCAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-375s1c1
Sequence:CCGGCCCAGTCATCGAATGTGACATCTCGAGATGTCACATTCGATGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-628s1c1
Sequence:CCGGACCGAGCAATATAATGAGCAACTCGAGTTGCTCATTATATTGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-629s1c1
Sequence:CCGGCCGAGCAATATAATGAGCAATCTCGAGATTGCTCATTATATTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009032
VALIDATED
RBM4 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009032.2-2205s21c1
Sequence:CCGGCATGATGCACTTCACTATTTACTCGAGTAAATAGTGAAGTGCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009032.2-929s21c1
Sequence:CCGGGCTGCCTCTGCGTATAGTAACCTCGAGGTTACTATACGCAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009032.2-1099s21c1
Sequence:CCGGTGCAGCTTCTACTTCATATTACTCGAGTAATATGAAGTAGAAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009032.2-1020s21c1
Sequence:CCGGCCTCTCTCGATCCCTACAATACTCGAGTATTGTAGGGATCGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009032.2-812s21c1
Sequence:CCGGACGCCTTACACCATGAGTTATCTCGAGATAACTCATGGTGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009032.1-1304s1c1
Sequence:CCGGCCTTGTTAAGTTCTTTCTCTTCTCGAGAAGAGAAAGAACTTAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-871s1c1
Sequence:CCGGCCTCTCTTGATCCCTACAATACTCGAGTATTGTAGGGATCAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-375s1c1
Sequence:CCGGCCCAGTCATCGAATGTGACATCTCGAGATGTCACATTCGATGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-628s1c1
Sequence:CCGGACCGAGCAATATAATGAGCAACTCGAGTTGCTCATTATATTGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-629s1c1
Sequence:CCGGCCGAGCAATATAATGAGCAATCTCGAGATTGCTCATTATATTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009032
VALIDATED
RBM4 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009032.2-2205s21c1
Sequence:CCGGCATGATGCACTTCACTATTTACTCGAGTAAATAGTGAAGTGCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009032.2-929s21c1
Sequence:CCGGGCTGCCTCTGCGTATAGTAACCTCGAGGTTACTATACGCAGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009032.2-1099s21c1
Sequence:CCGGTGCAGCTTCTACTTCATATTACTCGAGTAATATGAAGTAGAAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009032.2-1020s21c1
Sequence:CCGGCCTCTCTCGATCCCTACAATACTCGAGTATTGTAGGGATCGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009032.2-812s21c1
Sequence:CCGGACGCCTTACACCATGAGTTATCTCGAGATAACTCATGGTGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009032.1-1304s1c1
Sequence:CCGGCCTTGTTAAGTTCTTTCTCTTCTCGAGAAGAGAAAGAACTTAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-871s1c1
Sequence:CCGGCCTCTCTTGATCCCTACAATACTCGAGTATTGTAGGGATCAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-375s1c1
Sequence:CCGGCCCAGTCATCGAATGTGACATCTCGAGATGTCACATTCGATGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-628s1c1
Sequence:CCGGACCGAGCAATATAATGAGCAACTCGAGTTGCTCATTATATTGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009032.1-629s1c1
Sequence:CCGGCCGAGCAATATAATGAGCAATCTCGAGATTGCTCATTATATTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks