EMAIL THIS PAGE TO A FRIEND

RBMXL2

RNA binding motif protein, X-linked-like 2

Synonyms: HNRNPG-T HNRNPGT HNRPGT
UniProtKB ID: O75526, Q6PEZ2, Q9NQU0
Gene ID:
Human(27288) Summary: This gene belongs to the HNRPG subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two RRM domains that bind RNAs. This gene is intronless and is thought to be derived from a processed retroposon. However, unlike many retroposon-derived genes, this gene is not a pseudogene. The encoded protein has similarity to HNRPG and RBMY proteins and it is suggested to replace HNRPG protein function during meiotic prophase or act as a germ cell-specific splicing regulator. It primarily localizes to the nuclei of meiotic spermatocytes. This gene is a candidate for autosomal male infertility. [provided by RefSeq, Jul 2008]
Mouse(76572) RNA binding motif protein, X-linked-like 2
Rat(365344) RNA binding motif protein, X-linked-like 2
cow(617969) RNA binding motif protein, X-linked-like 2
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014469 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136741 MISSION® esiRNA esiRNA human RBMXL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014469 Rosetta Predictions human pricing
XR_006886 Rosetta Predictions rat pricing
XR_009075 Rosetta Predictions rat pricing
NM_029660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201868 predicted 1801
2 SASI_Hs01_00201869 predicted 902
3 SASI_Hs01_00201870 predicted 1750
4 SASI_Hs01_00201871 predicted 1682
5 SASI_Hs01_00201873 predicted 1636
6 SASI_Hs01_00201874 predicted 1488
7 SASI_Hs01_00201875 predicted 1818
8 SASI_Hs01_00201876 predicted 1554
9 SASI_Hs02_00345697 predicted 891
10 SASI_Hs02_00345698 predicted 1687
11 SASI_Hs01_00201867 predicted 1377
12 SASI_Hs01_00201872 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154131 predicted 236
2 SASI_Rn01_00154132 predicted 212
3 SASI_Rn01_00154133 predicted 378
4 SASI_Rn01_00154134 predicted 831
5 SASI_Rn01_00154135 predicted 932
6 SASI_Rn01_00154136 predicted 810
7 SASI_Rn01_00154137 predicted 824
8 SASI_Rn01_00154138 predicted 252
9 SASI_Rn02_00413101 predicted 282
10 SASI_Rn02_00413102 predicted 244
11 SASI_Rn01_00154139 predicted 905
12 SASI_Rn01_00154140 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152679 predicted 487
2 SASI_Rn01_00152680 predicted 381
3 SASI_Rn01_00152681 predicted 488
4 SASI_Rn02_00418691 predicted 540
5 SASI_Rn01_00152683 predicted 355
6 SASI_Rn01_00152684 predicted 330
7 SASI_Rn01_00152686 predicted 267
8 SASI_Rn02_00418692 predicted 326
9 SASI_Rn02_00418693 predicted 375
10 SASI_Rn02_00418694 predicted 452
11 SASI_Rn01_00152678 predicted 627
12 SASI_Rn01_00152682 predicted 208
13 SASI_Rn01_00152685 predicted 694
14 SASI_Rn01_00152687 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134718 predicted 1087
2 SASI_Mm01_00134719 predicted 254
3 SASI_Mm01_00134720 predicted 1030
4 SASI_Mm01_00134721 predicted 314
5 SASI_Mm01_00134722 predicted 1051
6 SASI_Mm02_00335685 predicted 518
7 SASI_Mm01_00134723 predicted 768
8 SASI_Mm01_00134724 predicted 275
9 SASI_Mm01_00134725 predicted 1022
10 SASI_Mm01_00134726 predicted 935
11 SASI_Mm01_00134727 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014469
RBMXL2 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, X-linked-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014469.4-291s21c1
Sequence:CCGGTCGAGGTGCTCCTGATGAAAGCTCGAGCTTTCATCAGGAGCACCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014469.4-895s21c1
Sequence:CCGGAGAGTACACCCACCGCGATTACTCGAGTAATCGCGGTGGGTGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014469.4-1819s21c1
Sequence:CCGGGGGTATCTTTCAAACTGAATCCTCGAGGATTCAGTTTGAAAGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014469.4-1631s21c1
Sequence:CCGGCAAGTAGAAATTCGATTAATGCTCGAGCATTAATCGAATTTCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014469.3-1620s1c1
Sequence:CCGGCGGATCATTCTGCTCATTTAACTCGAGTTAAATGAGCAGAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-264s1c1
Sequence:CCGGCGCCAGAGACATGAACGGCAACTCGAGTTGCCGTTCATGTCTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-288s1c1
Sequence:CCGGCCTGGATGGTAAGGCCATCAACTCGAGTTGATGGCCTTACCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-1038s1c1
Sequence:CCGGCGACAGTTACAGCAGCAGTTACTCGAGTAACTGCTGCTGTAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-142s1c1
Sequence:CCGGGAAGCCGAGTTTGGCAAGTATCTCGAGATACTTGCCAAACTCGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014469
RBMXL2 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, X-linked-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014469.4-291s21c1
Sequence:CCGGTCGAGGTGCTCCTGATGAAAGCTCGAGCTTTCATCAGGAGCACCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014469.4-895s21c1
Sequence:CCGGAGAGTACACCCACCGCGATTACTCGAGTAATCGCGGTGGGTGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014469.4-1819s21c1
Sequence:CCGGGGGTATCTTTCAAACTGAATCCTCGAGGATTCAGTTTGAAAGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014469.4-1631s21c1
Sequence:CCGGCAAGTAGAAATTCGATTAATGCTCGAGCATTAATCGAATTTCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014469.3-1620s1c1
Sequence:CCGGCGGATCATTCTGCTCATTTAACTCGAGTTAAATGAGCAGAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-264s1c1
Sequence:CCGGCGCCAGAGACATGAACGGCAACTCGAGTTGCCGTTCATGTCTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-288s1c1
Sequence:CCGGCCTGGATGGTAAGGCCATCAACTCGAGTTGATGGCCTTACCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-1038s1c1
Sequence:CCGGCGACAGTTACAGCAGCAGTTACTCGAGTAACTGCTGCTGTAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-142s1c1
Sequence:CCGGGAAGCCGAGTTTGGCAAGTATCTCGAGATACTTGCCAAACTCGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014469
RBMXL2 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, X-linked-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014469.4-291s21c1
Sequence:CCGGTCGAGGTGCTCCTGATGAAAGCTCGAGCTTTCATCAGGAGCACCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014469.4-895s21c1
Sequence:CCGGAGAGTACACCCACCGCGATTACTCGAGTAATCGCGGTGGGTGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014469.4-1819s21c1
Sequence:CCGGGGGTATCTTTCAAACTGAATCCTCGAGGATTCAGTTTGAAAGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014469.4-1631s21c1
Sequence:CCGGCAAGTAGAAATTCGATTAATGCTCGAGCATTAATCGAATTTCTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014469.3-1620s1c1
Sequence:CCGGCGGATCATTCTGCTCATTTAACTCGAGTTAAATGAGCAGAATGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-264s1c1
Sequence:CCGGCGCCAGAGACATGAACGGCAACTCGAGTTGCCGTTCATGTCTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-288s1c1
Sequence:CCGGCCTGGATGGTAAGGCCATCAACTCGAGTTGATGGCCTTACCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-1038s1c1
Sequence:CCGGCGACAGTTACAGCAGCAGTTACTCGAGTAACTGCTGCTGTAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014469.3-142s1c1
Sequence:CCGGGAAGCCGAGTTTGGCAAGTATCTCGAGATACTTGCCAAACTCGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029660
RBMXL2 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, X-linked-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-1094s1c1
Sequence:CCGGCGCCGTCTGTAGAACGAAACTCTCGAGAGTTTCGTTCTACAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-150s1c1
Sequence:CCGGCGGCAAGTATGGCCGCATCATCTCGAGATGATGCGGCCATACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-774s1c1
Sequence:CCGGCGACTACACCTACCGCGACTACTCGAGTAGTCGCGGTAGGTGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029660.1-1265s1c1
Sequence:CCGGGAAGAATCAGTTTCCTGGTAACTCGAGTTACCAGGAAACTGATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-139s1c1
Sequence:CCGGGAAACCGCTTTCGGCAAGTATCTCGAGATACTTGCCGAAAGCGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029660
RBMXL2 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, X-linked-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-1094s1c1
Sequence:CCGGCGCCGTCTGTAGAACGAAACTCTCGAGAGTTTCGTTCTACAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-150s1c1
Sequence:CCGGCGGCAAGTATGGCCGCATCATCTCGAGATGATGCGGCCATACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-774s1c1
Sequence:CCGGCGACTACACCTACCGCGACTACTCGAGTAGTCGCGGTAGGTGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029660.1-1265s1c1
Sequence:CCGGGAAGAATCAGTTTCCTGGTAACTCGAGTTACCAGGAAACTGATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-139s1c1
Sequence:CCGGGAAACCGCTTTCGGCAAGTATCTCGAGATACTTGCCGAAAGCGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029660
RBMXL2 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, X-linked-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-1094s1c1
Sequence:CCGGCGCCGTCTGTAGAACGAAACTCTCGAGAGTTTCGTTCTACAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-150s1c1
Sequence:CCGGCGGCAAGTATGGCCGCATCATCTCGAGATGATGCGGCCATACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-774s1c1
Sequence:CCGGCGACTACACCTACCGCGACTACTCGAGTAGTCGCGGTAGGTGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029660.1-1265s1c1
Sequence:CCGGGAAGAATCAGTTTCCTGGTAACTCGAGTTACCAGGAAACTGATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029660.1-139s1c1
Sequence:CCGGGAAACCGCTTTCGGCAAGTATCTCGAGATACTTGCCGAAAGCGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks