EMAIL THIS PAGE TO A FRIEND

RBMXL3

RNA binding motif protein, X-linked-like 3

Synonyms: CXorf55
Species: Human RBMXL3(139804)
UniProtKB ID: Q8N7X1, B4DXC0
Gene ID:
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152425 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001145346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145346 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152425 Rosetta Predictions human pricing
XR_017698 Rosetta Predictions human pricing
XR_017994 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031469 predicted 1850
2 SASI_Hs01_00031470 predicted 1803
3 SASI_Hs01_00031471 predicted 668
4 SASI_Hs01_00031472 predicted 968
5 SASI_Hs01_00031473 predicted 1763
6 SASI_Hs01_00031474 predicted 1591
7 SASI_Hs01_00031475 predicted 2059
8 SASI_Hs01_00031476 predicted 2048
9 SASI_Hs01_00031477 predicted 1771
10 SASI_Hs01_00031478 predicted 2002
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494022 predicted 1147
2 SASI_Hs02_00494023 predicted 2820
3 SASI_Hs02_00494024 predicted 826
4 SASI_Hs02_00494025 predicted 1443
5 SASI_Hs02_00494026 predicted 1644
6 SASI_Hs02_00494027 predicted 1546
7 SASI_Hs02_00494028 predicted 805
8 SASI_Hs02_00494029 predicted 2764
9 SASI_Hs02_00494030 predicted 2732
10 SASI_Hs02_00494031 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495215 predicted 1144
2 SASI_Hs02_00495216 predicted 2823
3 SASI_Hs02_00495217 predicted 822
4 SASI_Hs02_00495218 predicted 1440
5 SASI_Hs02_00495219 predicted 1640
6 SASI_Hs02_00495220 predicted 1550
7 SASI_Hs02_00495221 predicted 807
8 SASI_Hs02_00495222 predicted 2765
9 SASI_Hs02_00495223 predicted 2734
10 SASI_Hs02_00495224 predicted 1248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152425
RBMXL3 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, X-linked-like 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1770s1c1
Sequence:CCGGGCCGGAGTGACCATTACGGAACTCGAGTTCCGTAATGGTCACTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152425.1-2317s1c1
Sequence:CCGGGAAGAACCTGTTCTATGTTAACTCGAGTTAACATAGAACAGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1590s1c1
Sequence:CCGGGTGACAGTTCCAGCAACAGTTCTCGAGAACTGTTGCTGGAACTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152425.1-2320s1c1
Sequence:CCGGGAACCTGTTCTATGTTAACTACTCGAGTAGTTAACATAGAACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1748s1c1
Sequence:CCGGGACAGTTTCAGCAACAGCTATCTCGAGATAGCTGTTGCTGAAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1855s1c1
Sequence:CCGGCAACAGTTCCAACAACAGTCACTCGAGTGACTGTTGTTGGAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152425
RBMXL3 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, X-linked-like 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1770s1c1
Sequence:CCGGGCCGGAGTGACCATTACGGAACTCGAGTTCCGTAATGGTCACTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152425.1-2317s1c1
Sequence:CCGGGAAGAACCTGTTCTATGTTAACTCGAGTTAACATAGAACAGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1590s1c1
Sequence:CCGGGTGACAGTTCCAGCAACAGTTCTCGAGAACTGTTGCTGGAACTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152425.1-2320s1c1
Sequence:CCGGGAACCTGTTCTATGTTAACTACTCGAGTAGTTAACATAGAACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1748s1c1
Sequence:CCGGGACAGTTTCAGCAACAGCTATCTCGAGATAGCTGTTGCTGAAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1855s1c1
Sequence:CCGGCAACAGTTCCAACAACAGTCACTCGAGTGACTGTTGTTGGAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152425
RBMXL3 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, X-linked-like 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1770s1c1
Sequence:CCGGGCCGGAGTGACCATTACGGAACTCGAGTTCCGTAATGGTCACTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152425.1-2317s1c1
Sequence:CCGGGAAGAACCTGTTCTATGTTAACTCGAGTTAACATAGAACAGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1590s1c1
Sequence:CCGGGTGACAGTTCCAGCAACAGTTCTCGAGAACTGTTGCTGGAACTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152425.1-2320s1c1
Sequence:CCGGGAACCTGTTCTATGTTAACTACTCGAGTAGTTAACATAGAACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1748s1c1
Sequence:CCGGGACAGTTTCAGCAACAGCTATCTCGAGATAGCTGTTGCTGAAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152425.1-1855s1c1
Sequence:CCGGCAACAGTTCCAACAACAGTCACTCGAGTGACTGTTGTTGGAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145346
RBMXL3 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, X-linked-like 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000438332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-1121s21c1
Sequence:CCGGACCACTCGCCCAAAGCCTATACTCGAGTATAGGCTTTGGGCGAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-2933s21c1
Sequence:CCGGGCGACAGTTCCATCAAGAGTTCTCGAGAACTCTTGATGGAACTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-3037s21c1
Sequence:CCGGGACAGATCCAGCAACAGTTACCTCGAGGTAACTGTTGCTGGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-1448s21c1
Sequence:CCGGGCCGTTATGAGGAGTACCAAGCTCGAGCTTGGTACTCCTCATAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145346
RBMXL3 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, X-linked-like 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000438332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-1121s21c1
Sequence:CCGGACCACTCGCCCAAAGCCTATACTCGAGTATAGGCTTTGGGCGAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-2933s21c1
Sequence:CCGGGCGACAGTTCCATCAAGAGTTCTCGAGAACTCTTGATGGAACTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-3037s21c1
Sequence:CCGGGACAGATCCAGCAACAGTTACCTCGAGGTAACTGTTGCTGGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-1448s21c1
Sequence:CCGGGCCGTTATGAGGAGTACCAAGCTCGAGCTTGGTACTCCTCATAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145346
RBMXL3 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, X-linked-like 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000438332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-1121s21c1
Sequence:CCGGACCACTCGCCCAAAGCCTATACTCGAGTATAGGCTTTGGGCGAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-2933s21c1
Sequence:CCGGGCGACAGTTCCATCAAGAGTTCTCGAGAACTCTTGATGGAACTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-3037s21c1
Sequence:CCGGGACAGATCCAGCAACAGTTACCTCGAGGTAACTGTTGCTGGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145346.1-1448s21c1
Sequence:CCGGGCCGTTATGAGGAGTACCAAGCTCGAGCTTGGTACTCCTCATAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks