EMAIL THIS PAGE TO A FRIEND

RBMY1A1

RNA binding motif protein, Y-linked, family 1, member A1

Synonyms: RBM RBM1 RBM2 RBMY RBMY1C YRRM1 YRRM2
Gene ID:
Human(5940) Summary: This gene encodes a protein containing an RNA-binding motif in the N-terminus and four SRGY (serine, arginine, glycine, tyrosine) boxes in the C-terminus. Multiple copies of this gene are found in the AZFb azoospermia factor region of chromosome Y and the encoded protein is thought to be involved in spermatogenesis. Most copies of this locus are pseudogenes, although six highly similar copies have full-length ORFs and are considered functional. Four functional copies of this gene are found within inverted repeat IR2; two functional copies of this gene are found in palindrome P3, along with two copies of PTPN13-like, Y-linked. [provided by RefSeq, Jul 2008]
cow(282465) RNA binding motif protein, Y-linked, family 1, member A1
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005058 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007526 Rosetta Predictions human pricing
NM_005058 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058109 predicted 788
2 SASI_Hs01_00058110 predicted 899
3 SASI_Hs01_00058111 predicted 802
4 SASI_Hs01_00058112 predicted 791
5 SASI_Hs01_00058113 predicted 722
6 SASI_Hs01_00058114 predicted 724
7 SASI_Hs01_00058115 predicted 873
8 SASI_Hs01_00058116 predicted 751
9 SASI_Hs01_00058117 predicted 672
10 SASI_Hs01_00058118 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102425 predicted 954
2 SASI_Hs01_00102426 predicted 1070
3 SASI_Hs01_00102427 predicted 965
4 SASI_Hs01_00102428 predicted 953
5 SASI_Hs01_00102429 predicted 891
6 SASI_Hs01_00102430 predicted 888
7 SASI_Hs01_00102431 predicted 1037
8 SASI_Hs01_00102432 predicted 907
9 SASI_Hs01_00102433 predicted 834
10 SASI_Hs01_00102434 predicted 804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005058
RBMY1A1 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, Y-linked, family 1, member A1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-1145s1c1
Sequence:CCGGGCTCCACCACATAGAGACTATCTCGAGATAGTCTCTATGTGGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-838s1c1
Sequence:CCGGCCGTGATAATGGTCATTCTAACTCGAGTTAGAATGACCATTATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005058.2-1691s1c1
Sequence:CCGGCCTGCATATTACTGAAAGAAACTCGAGTTTCTTTCAGTAATATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-737s1c1
Sequence:CCGGCGCATGTCAACAAGACATGATCTCGAGATCATGTCTTGTTGACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-252s1c1
Sequence:CCGGGCAAATCCAGAGGCTTTGCATCTCGAGATGCAAAGCCTCTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005058
RBMY1A1 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, Y-linked, family 1, member A1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-1145s1c1
Sequence:CCGGGCTCCACCACATAGAGACTATCTCGAGATAGTCTCTATGTGGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-838s1c1
Sequence:CCGGCCGTGATAATGGTCATTCTAACTCGAGTTAGAATGACCATTATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005058.2-1691s1c1
Sequence:CCGGCCTGCATATTACTGAAAGAAACTCGAGTTTCTTTCAGTAATATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-737s1c1
Sequence:CCGGCGCATGTCAACAAGACATGATCTCGAGATCATGTCTTGTTGACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-252s1c1
Sequence:CCGGGCAAATCCAGAGGCTTTGCATCTCGAGATGCAAAGCCTCTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005058
RBMY1A1 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, Y-linked, family 1, member A1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-1145s1c1
Sequence:CCGGGCTCCACCACATAGAGACTATCTCGAGATAGTCTCTATGTGGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-838s1c1
Sequence:CCGGCCGTGATAATGGTCATTCTAACTCGAGTTAGAATGACCATTATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005058.2-1691s1c1
Sequence:CCGGCCTGCATATTACTGAAAGAAACTCGAGTTTCTTTCAGTAATATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-737s1c1
Sequence:CCGGCGCATGTCAACAAGACATGATCTCGAGATCATGTCTTGTTGACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005058.2-252s1c1
Sequence:CCGGGCAAATCCAGAGGCTTTGCATCTCGAGATGCAAAGCCTCTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks