EMAIL THIS PAGE TO A FRIEND

RBPJL

recombination signal binding protein for immunoglobulin kappa J region-like

Synonyms: RBPSUHL SUHL
UniProtKB ID: Q9UBG7, O95723, Q5QPU9, Q5QPV0, Q9ULV9
Gene ID:
Human(11317) Summary: In mouse, recombining binding protein L (RBP-L) is a transcription factor that binds to DNA sequences almost identical to that bound by the Notch receptor signalling pathway transcription factor RBP-J. However, unlike RBP-J, RBP-L does not interact with Notch receptors. RBP-L has been shown to activate transcription in concert with Epstein-Barr virus nuclear antigen-2 (EBNA2). The protein encoded by this gene is similar in sequence to the mouse RPB-L protein and Drosophila suppressor of hairless protein. [provided by RefSeq, Jul 2008]
Mouse(19668) recombination signal binding protein for immunoglobulin kappa J region-like
Rat(362268) recombination signal binding protein for immunoglobulin kappa J region-like
Zebrafish(503870) recombination signal binding protein for immunoglobulin kappa J region-like
chicken(419185) recombination signal binding protein for immunoglobulin kappa J region-like
Horse(100070913) recombination signal binding protein for immunoglobulin kappa J region-like
domestic cat(101088656) recombination signal binding protein for immunoglobulin kappa J region-like
dog(485892) recombination signal binding protein for immunoglobulin kappa J region-like
cow(540059) recombination signal binding protein for immunoglobulin kappa J region-like
sheep(101111217) recombination signal binding protein for immunoglobulin kappa J region-like
naked mole-rat(101701560) recombination signal binding protein for immunoglobulin kappa J region-like
domestic guinea pig(100717262) recombination signal binding protein for immunoglobulin kappa J region-like
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34313 Anti-RBPJL antibody produced in rabbit IgG fraction of antiserum bovine, rat, human, mouse, guinea pig, horse
western blot pricing
SAB2101963 Anti-RBPJL antibody produced in rabbit affinity isolated antibody horse, zebrafish, rabbit, guinea pig, mouse, canine, bovine, human, rat
western blot pricing
SAB1410181 Anti-RBPJL antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009036 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009036 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009036 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014276 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014276 Rosetta Predictions human pricing
NM_001108604 Rosetta Predictions rat pricing
NM_009036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044526 predicted 1112
2 SASI_Hs02_00345348 predicted 698
3 SASI_Hs01_00044529 predicted 690
4 SASI_Hs02_00345349 predicted 298
5 SASI_Hs01_00044530 predicted 509
6 SASI_Hs01_00044531 predicted 1011
7 SASI_Hs01_00044532 predicted 433
8 SASI_Hs01_00044533 predicted 312
9 SASI_Hs01_00044534 predicted 926
10 SASI_Hs02_00345350 predicted 745
11 SASI_Hs01_00044525 predicted 1599
12 SASI_Hs01_00044527 predicted 301
13 SASI_Hs01_00044528 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240269 predicted 317
2 SASI_Rn02_00240270 predicted 2197
3 SASI_Rn02_00240271 predicted 549
4 SASI_Rn02_00240272 predicted 1427
5 SASI_Rn02_00240273 predicted 1392
6 SASI_Rn02_00240274 predicted 2178
7 SASI_Rn02_00240275 predicted 1120
8 SASI_Rn02_00240276 predicted 589
9 SASI_Rn02_00240277 predicted 766
10 SASI_Rn02_00240278 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047145 predicted 709
2 SASI_Mm01_00047146 predicted 1075
3 SASI_Mm01_00047147 predicted 942
4 SASI_Mm01_00047148 predicted 1948
5 SASI_Mm01_00047149 predicted 562
6 SASI_Mm01_00047150 predicted 277
7 SASI_Mm01_00047151 predicted 940
8 SASI_Mm01_00047152 predicted 1754
9 SASI_Mm01_00047153 predicted 2005
10 SASI_Mm01_00047154 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009036
RBPJL MISSION shRNA Bacterial Glycerol Stock
recombination signal binding protein for immunoglobulin kappa J region-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009036.1-2271s1c1
Sequence:CCGGCCATCCAAACCAGAGTCTGATCTCGAGATCAGACTCTGGTTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-955s1c1
Sequence:CCGGGCCGCCTATGATCATCCGAAACTCGAGTTTCGGATGATCATAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-404s1c1
Sequence:CCGGGTGAAGCCAATGCAAGACCAACTCGAGTTGGTCTTGCATTGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-1382s1c1
Sequence:CCGGCCTCGTTCCTTGGTGTGCGTACTCGAGTACGCACACCAAGGAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-577s1c1
Sequence:CCGGCGCCGATAAGAGGAAGCACTTCTCGAGAAGTGCTTCCTCTTATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009036
RBPJL MISSION shRNA shRNA Plasmid DNA
recombination signal binding protein for immunoglobulin kappa J region-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009036.1-2271s1c1
Sequence:CCGGCCATCCAAACCAGAGTCTGATCTCGAGATCAGACTCTGGTTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-955s1c1
Sequence:CCGGGCCGCCTATGATCATCCGAAACTCGAGTTTCGGATGATCATAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-404s1c1
Sequence:CCGGGTGAAGCCAATGCAAGACCAACTCGAGTTGGTCTTGCATTGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-1382s1c1
Sequence:CCGGCCTCGTTCCTTGGTGTGCGTACTCGAGTACGCACACCAAGGAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-577s1c1
Sequence:CCGGCGCCGATAAGAGGAAGCACTTCTCGAGAAGTGCTTCCTCTTATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009036
RBPJL MISSION shRNA Lentiviral Transduction Particles
recombination signal binding protein for immunoglobulin kappa J region-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009036.1-2271s1c1
Sequence:CCGGCCATCCAAACCAGAGTCTGATCTCGAGATCAGACTCTGGTTTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-955s1c1
Sequence:CCGGGCCGCCTATGATCATCCGAAACTCGAGTTTCGGATGATCATAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-404s1c1
Sequence:CCGGGTGAAGCCAATGCAAGACCAACTCGAGTTGGTCTTGCATTGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-1382s1c1
Sequence:CCGGCCTCGTTCCTTGGTGTGCGTACTCGAGTACGCACACCAAGGAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009036.1-577s1c1
Sequence:CCGGCGCCGATAAGAGGAAGCACTTCTCGAGAAGTGCTTCCTCTTATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014276
RBPJL MISSION shRNA Bacterial Glycerol Stock
recombination signal binding protein for immunoglobulin kappa J region-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-301s1c1
Sequence:CCGGGCCCAGAAATCATACGGAAATCTCGAGATTTCCGTATGATTTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-553s1c1
Sequence:CCGGGCAGACAAGAGGAAGCACTTTCTCGAGAAAGTGCTTCCTCTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-1002s1c1
Sequence:CCGGGCACAAGTGTGCATTCCAGTTCTCGAGAACTGGAATGCACACTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-1134s1c1
Sequence:CCGGCGACAGCTCTTGCTGGACCATCTCGAGATGGTCCAGCAAGAGCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014276.2-1741s21c1
Sequence:CCGGCTGAAGGCTCACCCTAGAAACCTCGAGGTTTCTAGGGTGAGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014276.2-694s21c1
Sequence:CCGGTGCATATCCTCCGGCTCAAAGCTCGAGCTTTGAGCCGGAGGATATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014276.2-1840s21c1
Sequence:CCGGTCTTTGTGTCCGTCGTGTATGCTCGAGCATACACGACGGACACAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014276
RBPJL MISSION shRNA shRNA Plasmid DNA
recombination signal binding protein for immunoglobulin kappa J region-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-301s1c1
Sequence:CCGGGCCCAGAAATCATACGGAAATCTCGAGATTTCCGTATGATTTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-553s1c1
Sequence:CCGGGCAGACAAGAGGAAGCACTTTCTCGAGAAAGTGCTTCCTCTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-1002s1c1
Sequence:CCGGGCACAAGTGTGCATTCCAGTTCTCGAGAACTGGAATGCACACTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-1134s1c1
Sequence:CCGGCGACAGCTCTTGCTGGACCATCTCGAGATGGTCCAGCAAGAGCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014276.2-1741s21c1
Sequence:CCGGCTGAAGGCTCACCCTAGAAACCTCGAGGTTTCTAGGGTGAGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014276.2-694s21c1
Sequence:CCGGTGCATATCCTCCGGCTCAAAGCTCGAGCTTTGAGCCGGAGGATATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014276.2-1840s21c1
Sequence:CCGGTCTTTGTGTCCGTCGTGTATGCTCGAGCATACACGACGGACACAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014276
RBPJL MISSION shRNA Lentiviral Transduction Particles
recombination signal binding protein for immunoglobulin kappa J region-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-301s1c1
Sequence:CCGGGCCCAGAAATCATACGGAAATCTCGAGATTTCCGTATGATTTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-553s1c1
Sequence:CCGGGCAGACAAGAGGAAGCACTTTCTCGAGAAAGTGCTTCCTCTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-1002s1c1
Sequence:CCGGGCACAAGTGTGCATTCCAGTTCTCGAGAACTGGAATGCACACTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014276.2-1134s1c1
Sequence:CCGGCGACAGCTCTTGCTGGACCATCTCGAGATGGTCCAGCAAGAGCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014276.2-1741s21c1
Sequence:CCGGCTGAAGGCTCACCCTAGAAACCTCGAGGTTTCTAGGGTGAGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014276.2-694s21c1
Sequence:CCGGTGCATATCCTCCGGCTCAAAGCTCGAGCTTTGAGCCGGAGGATATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014276.2-1840s21c1
Sequence:CCGGTCTTTGTGTCCGTCGTGTATGCTCGAGCATACACGACGGACACAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks