EMAIL THIS PAGE TO A FRIEND

RD3

retinal degeneration 3

Synonyms: C1orf36 LCA12
UniProtKB ID: Q7Z3Z2, A8K595
Gene ID:
Human(343035) Summary: This gene encodes a retinal protein that is associated with promyelocytic leukemia-gene product (PML) bodies in the nucleus. Mutations in this gene cause Leber congenital amaurosis type 12, a disease that results in retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(74023) retinal degeneration 3
Rat(684158) retinal degeneration 3
Zebrafish(791149) retinal degeneration 3
dog(609870) retinal degeneration 3
domestic cat(101092413) retinal degeneration 3
chicken(421378) retinal degeneration 3
cow(787231) retinal degeneration 3
sheep(101104168) retinal degeneration 3
naked mole-rat(101702976) retinal degeneration 3
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183059 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043801 MISSION® esiRNA esiRNA human RD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183059 Rosetta Predictions human pricing
XM_001069205 Rosetta Predictions rat pricing
NM_023727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221742 predicted 1301
2 SASI_Hs01_00221743 predicted 1867
3 SASI_Hs01_00221744 predicted 1395
4 SASI_Hs01_00221745 predicted 1870
5 SASI_Hs01_00221746 predicted 1838
6 SASI_Hs01_00221747 predicted 2176
7 SASI_Hs01_00221748 predicted 1394
8 SASI_Hs01_00221749 predicted 2176
9 SASI_Hs01_00221750 predicted 1560
10 SASI_Hs01_00221751 predicted 2122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327253 predicted 253
2 SASI_Rn02_00327254 predicted 791
3 SASI_Rn02_00327255 predicted 250
4 SASI_Rn02_00327256 predicted 401
5 SASI_Rn02_00327257 predicted 726
6 SASI_Rn02_00327258 predicted 593
7 SASI_Rn02_00327259 predicted 746
8 SASI_Rn02_00327260 predicted 709
9 SASI_Rn02_00327261 predicted 758
10 SASI_Rn02_00327262 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131809 predicted 822
2 SASI_Mm01_00131810 predicted 505
3 SASI_Mm01_00131811 predicted 813
4 SASI_Mm01_00131812 predicted 590
5 SASI_Mm01_00131813 predicted 739
6 SASI_Mm01_00131814 predicted 680
7 SASI_Mm01_00131815 predicted 1055
8 SASI_Mm01_00131816 predicted 1088
9 SASI_Mm01_00131817 predicted 1025
10 SASI_Mm01_00131818 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183059
RD3 MISSION shRNA Bacterial Glycerol Stock
retinal degeneration 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183059.2-1452s21c1
Sequence:CCGGTATCCTCAGGTTCCGGCAGCTCTCGAGAGCTGCCGGAACCTGAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183059.1-2391s1c1
Sequence:CCGGCCTGCATGAATAGTGTCTGTTCTCGAGAACAGACACTATTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1244s1c1
Sequence:CCGGAGACGCTTATGATGGAGCTGACTCGAGTCAGCTCCATCATAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1404s1c1
Sequence:CCGGGCTGGAAGATGTCTGCGTTAACTCGAGTTAACGCAGACATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1420s1c1
Sequence:CCGGGTTAAGATCCACCCATCCTATCTCGAGATAGGATGGGTGGATCTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1650s1c1
Sequence:CCGGCGCCAGCGACATCAGGACCATCTCGAGATGGTCCTGATGTCGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183059
RD3 MISSION shRNA shRNA Plasmid DNA
retinal degeneration 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183059.2-1452s21c1
Sequence:CCGGTATCCTCAGGTTCCGGCAGCTCTCGAGAGCTGCCGGAACCTGAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183059.1-2391s1c1
Sequence:CCGGCCTGCATGAATAGTGTCTGTTCTCGAGAACAGACACTATTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1244s1c1
Sequence:CCGGAGACGCTTATGATGGAGCTGACTCGAGTCAGCTCCATCATAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1404s1c1
Sequence:CCGGGCTGGAAGATGTCTGCGTTAACTCGAGTTAACGCAGACATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1420s1c1
Sequence:CCGGGTTAAGATCCACCCATCCTATCTCGAGATAGGATGGGTGGATCTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1650s1c1
Sequence:CCGGCGCCAGCGACATCAGGACCATCTCGAGATGGTCCTGATGTCGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183059
RD3 MISSION shRNA Lentiviral Transduction Particles
retinal degeneration 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183059.2-1452s21c1
Sequence:CCGGTATCCTCAGGTTCCGGCAGCTCTCGAGAGCTGCCGGAACCTGAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183059.1-2391s1c1
Sequence:CCGGCCTGCATGAATAGTGTCTGTTCTCGAGAACAGACACTATTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1244s1c1
Sequence:CCGGAGACGCTTATGATGGAGCTGACTCGAGTCAGCTCCATCATAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1404s1c1
Sequence:CCGGGCTGGAAGATGTCTGCGTTAACTCGAGTTAACGCAGACATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1420s1c1
Sequence:CCGGGTTAAGATCCACCCATCCTATCTCGAGATAGGATGGGTGGATCTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183059.1-1650s1c1
Sequence:CCGGCGCCAGCGACATCAGGACCATCTCGAGATGGTCCTGATGTCGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023727
RD3 MISSION shRNA Bacterial Glycerol Stock
retinal degeneration 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-825s21c1
Sequence:CCGGCCAGTGACATCCGAACCATCTCTCGAGAGATGGTTCGGATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-597s21c1
Sequence:CCGGAGATCCACCCATCCTACTGTGCTCGAGCACAGTAGGATGGGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023727.2-1153s21c1
Sequence:CCGGCCCACATACTCATCCCAATTTCTCGAGAAATTGGGATGAGTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-512s21c1
Sequence:CCGGGACTACAGCTGGTTGGCAAACCTCGAGGTTTGCCAACCAGCTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-742s21c1
Sequence:CCGGCCATAAGCTGACACGTCAGTGCTCGAGCACTGACGTGTCAGCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023727
RD3 MISSION shRNA shRNA Plasmid DNA
retinal degeneration 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-825s21c1
Sequence:CCGGCCAGTGACATCCGAACCATCTCTCGAGAGATGGTTCGGATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-597s21c1
Sequence:CCGGAGATCCACCCATCCTACTGTGCTCGAGCACAGTAGGATGGGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023727.2-1153s21c1
Sequence:CCGGCCCACATACTCATCCCAATTTCTCGAGAAATTGGGATGAGTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-512s21c1
Sequence:CCGGGACTACAGCTGGTTGGCAAACCTCGAGGTTTGCCAACCAGCTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-742s21c1
Sequence:CCGGCCATAAGCTGACACGTCAGTGCTCGAGCACTGACGTGTCAGCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023727
RD3 MISSION shRNA Lentiviral Transduction Particles
retinal degeneration 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-825s21c1
Sequence:CCGGCCAGTGACATCCGAACCATCTCTCGAGAGATGGTTCGGATGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-597s21c1
Sequence:CCGGAGATCCACCCATCCTACTGTGCTCGAGCACAGTAGGATGGGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023727.2-1153s21c1
Sequence:CCGGCCCACATACTCATCCCAATTTCTCGAGAAATTGGGATGAGTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-512s21c1
Sequence:CCGGGACTACAGCTGGTTGGCAAACCTCGAGGTTTGCCAACCAGCTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023727.2-742s21c1
Sequence:CCGGCCATAAGCTGACACGTCAGTGCTCGAGCACTGACGTGTCAGCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks