EMAIL THIS PAGE TO A FRIEND

RDH14

retinol dehydrogenase 14 (all-trans/9-cis/11-cis)

Synonyms: PAN2 SDR7C4
UniProtKB ID: Q9HBH5
Gene ID:
Mouse(105014) retinol dehydrogenase 14 (all-trans and 9-cis)
Rat(500629) retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
domestic guinea pig(101788106) retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
cow(505949) retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
chicken(421953) retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
dog(482983) retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
domestic cat(101081536) retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020905 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020905 Rosetta Predictions human pricing
NM_001109276 Rosetta Predictions rat pricing
NM_023697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079689 predicted 760
2 SASI_Hs01_00079690 predicted 831
3 SASI_Hs01_00079691 predicted 1099
4 SASI_Hs01_00079692 predicted 572
5 SASI_Hs01_00079693 predicted 1119
6 SASI_Hs01_00079694 predicted 740
7 SASI_Hs01_00079695 predicted 758
8 SASI_Hs01_00079696 predicted 793
9 SASI_Hs01_00079697 predicted 707
10 SASI_Hs02_00354243 predicted 674
11 SASI_Hs01_00079698 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246824 predicted 1066
2 SASI_Rn02_00246825 predicted 848
3 SASI_Rn02_00246826 predicted 1047
4 SASI_Rn02_00246827 predicted 1018
5 SASI_Rn02_00246828 predicted 959
6 SASI_Rn02_00246829 predicted 1206
7 SASI_Rn02_00246830 predicted 1150
8 SASI_Rn02_00246831 predicted 1347
9 SASI_Rn02_00246832 predicted 1416
10 SASI_Rn02_00246833 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160279 predicted 567
2 SASI_Mm01_00160280 predicted 407
3 SASI_Mm01_00160281 predicted 664
4 SASI_Mm01_00160282 predicted 826
5 SASI_Mm01_00160283 predicted 771
6 SASI_Mm02_00327298 predicted 676
7 SASI_Mm01_00160284 predicted 677
8 SASI_Mm01_00160285 predicted 211
9 SASI_Mm01_00160286 predicted 661
10 SASI_Mm01_00160287 predicted 770
11 SASI_Mm01_00160278 predicted 645
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023697
RDH14 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-623s1c1
Sequence:CCGGGCAGGATTGTAGTCGTTTCTTCTCGAGAAGAAACGACTACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-687s1c1
Sequence:CCGGCAGTGAGCAAAGCTATAATAACTCGAGTTATTATAGCTTTGCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-765s1c1
Sequence:CCGGCCGTCGCTTAGAAGGAACAAACTCGAGTTTGTTCCTTCTAAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-923s1c1
Sequence:CCGGCTTCCATCTATTTAGCCTGTTCTCGAGAACAGGCTAAATAGATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-514s1c1
Sequence:CCGGCCGTATACGAAGACTGAAGATCTCGAGATCTTCAGTCTTCGTATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023697
RDH14 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-623s1c1
Sequence:CCGGGCAGGATTGTAGTCGTTTCTTCTCGAGAAGAAACGACTACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-687s1c1
Sequence:CCGGCAGTGAGCAAAGCTATAATAACTCGAGTTATTATAGCTTTGCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-765s1c1
Sequence:CCGGCCGTCGCTTAGAAGGAACAAACTCGAGTTTGTTCCTTCTAAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-923s1c1
Sequence:CCGGCTTCCATCTATTTAGCCTGTTCTCGAGAACAGGCTAAATAGATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-514s1c1
Sequence:CCGGCCGTATACGAAGACTGAAGATCTCGAGATCTTCAGTCTTCGTATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023697
RDH14 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-623s1c1
Sequence:CCGGGCAGGATTGTAGTCGTTTCTTCTCGAGAAGAAACGACTACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-687s1c1
Sequence:CCGGCAGTGAGCAAAGCTATAATAACTCGAGTTATTATAGCTTTGCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-765s1c1
Sequence:CCGGCCGTCGCTTAGAAGGAACAAACTCGAGTTTGTTCCTTCTAAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-923s1c1
Sequence:CCGGCTTCCATCTATTTAGCCTGTTCTCGAGAACAGGCTAAATAGATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023697.1-514s1c1
Sequence:CCGGCCGTATACGAAGACTGAAGATCTCGAGATCTTCAGTCTTCGTATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020905
VALIDATED
RDH14 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_020905.1-468s1c1
Sequence:CCGGGCTGGATGTCTTGATCAATAACTCGAGTTATTGATCAAGACATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020905.1-718s1c1
Sequence:CCGGCGGAGCAAACTGGCTAACATTCTCGAGAATGTTAGCCAGTTTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020905.1-802s1c1
Sequence:CCGGCCTGGTATTGTACGGACAAATCTCGAGATTTGTCCGTACAATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020905.1-760s1c1
Sequence:CCGGCGCCGCTTAGAAGGCACAAATCTCGAGATTTGTGCCTTCTAAGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020905.1-614s1c1
Sequence:CCGGCCAGCAGGATTGTGGTAGTTTCTCGAGAAACTACCACAATCCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-1011s21c1
Sequence:CCGGGAGTGTCAGGAAGATACTTTGCTCGAGCAAAGTATCTTCCTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-736s21c1
Sequence:CCGGGAACAGTGAACAAAGCTATAACTCGAGTTATAGCTTTGTTCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-908s21c1
Sequence:CCGGTTGGTCAAACCACTCTTCAATCTCGAGATTGAAGAGTGGTTTGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020905.3-1197s21c1
Sequence:CCGGGTGGATTGAGAACTTGTTACTCTCGAGAGTAACAAGTTCTCAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-1108s21c1
Sequence:CCGGAGTGATGGTTGGCCTGCTAAACTCGAGTTTAGCAGGCCAACCATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-705s21c1
Sequence:CCAGATAAATACGGAGACATCAATTCTCGAGAATTGATGTCTCCGTATTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020905
VALIDATED
RDH14 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_020905.1-468s1c1
Sequence:CCGGGCTGGATGTCTTGATCAATAACTCGAGTTATTGATCAAGACATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020905.1-718s1c1
Sequence:CCGGCGGAGCAAACTGGCTAACATTCTCGAGAATGTTAGCCAGTTTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020905.1-802s1c1
Sequence:CCGGCCTGGTATTGTACGGACAAATCTCGAGATTTGTCCGTACAATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020905.1-760s1c1
Sequence:CCGGCGCCGCTTAGAAGGCACAAATCTCGAGATTTGTGCCTTCTAAGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020905.1-614s1c1
Sequence:CCGGCCAGCAGGATTGTGGTAGTTTCTCGAGAAACTACCACAATCCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-1011s21c1
Sequence:CCGGGAGTGTCAGGAAGATACTTTGCTCGAGCAAAGTATCTTCCTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-736s21c1
Sequence:CCGGGAACAGTGAACAAAGCTATAACTCGAGTTATAGCTTTGTTCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-908s21c1
Sequence:CCGGTTGGTCAAACCACTCTTCAATCTCGAGATTGAAGAGTGGTTTGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020905.3-1197s21c1
Sequence:CCGGGTGGATTGAGAACTTGTTACTCTCGAGAGTAACAAGTTCTCAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-1108s21c1
Sequence:CCGGAGTGATGGTTGGCCTGCTAAACTCGAGTTTAGCAGGCCAACCATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-705s21c1
Sequence:CCAGATAAATACGGAGACATCAATTCTCGAGAATTGATGTCTCCGTATTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020905
VALIDATED
RDH14 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 14 (all-trans/9-cis/11-cis)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_020905.1-468s1c1
Sequence:CCGGGCTGGATGTCTTGATCAATAACTCGAGTTATTGATCAAGACATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020905.1-718s1c1
Sequence:CCGGCGGAGCAAACTGGCTAACATTCTCGAGAATGTTAGCCAGTTTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020905.1-802s1c1
Sequence:CCGGCCTGGTATTGTACGGACAAATCTCGAGATTTGTCCGTACAATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020905.1-760s1c1
Sequence:CCGGCGCCGCTTAGAAGGCACAAATCTCGAGATTTGTGCCTTCTAAGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020905.1-614s1c1
Sequence:CCGGCCAGCAGGATTGTGGTAGTTTCTCGAGAAACTACCACAATCCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-1011s21c1
Sequence:CCGGGAGTGTCAGGAAGATACTTTGCTCGAGCAAAGTATCTTCCTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-736s21c1
Sequence:CCGGGAACAGTGAACAAAGCTATAACTCGAGTTATAGCTTTGTTCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-908s21c1
Sequence:CCGGTTGGTCAAACCACTCTTCAATCTCGAGATTGAAGAGTGGTTTGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020905.3-1197s21c1
Sequence:CCGGGTGGATTGAGAACTTGTTACTCTCGAGAGTAACAAGTTCTCAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-1108s21c1
Sequence:CCGGAGTGATGGTTGGCCTGCTAAACTCGAGTTTAGCAGGCCAACCATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020905.3-705s21c1
Sequence:CCAGATAAATACGGAGACATCAATTCTCGAGAATTGATGTCTCCGTATTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks