EMAIL THIS PAGE TO A FRIEND

RECQL4

RecQ protein-like 4

Synonyms: RECQ4
UniProtKB ID: O94761, Q3Y424, Q96DW2, Q96F55
Gene ID:
Human(9401) Summary: The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
Mouse(79456) RecQ protein-like 4
Rat(300057) RecQ protein-like 4
chicken(429982) RecQ protein-like 4
dog(482101) RecQ protein-like 4
domestic cat(101097700) RecQ protein-like 4
Horse(100064627) RecQ protein-like 4
cow(515472) RecQ protein-like 4
sheep(101107029) RecQ protein-like 4
domestic guinea pig(100736086) RecQ protein-like 4
naked mole-rat(101710862) RecQ protein-like 4
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_058214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_058214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004260 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137391 MISSION® esiRNA esiRNA human RECQL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004260 Rosetta Predictions human pricing
NM_001130494 Rosetta Predictions rat pricing
NM_058214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135884 predicted 2743
2 SASI_Hs01_00135885 predicted 582
3 SASI_Hs02_00337217 predicted 298
4 SASI_Hs01_00135888 predicted 1082
5 SASI_Hs01_00135890 predicted 1664
6 SASI_Hs02_00337218 predicted 1233
7 SASI_Hs01_00135891 predicted 2845
8 SASI_Hs02_00337219 predicted 1296
9 SASI_Hs02_00337220 predicted 2122
10 SASI_Hs02_00337221 predicted 3250
11 SASI_Hs01_00135886 predicted 1114
12 SASI_Hs01_00135887 predicted 1522
13 SASI_Hs01_00135889 predicted 2489
14 SASI_Hs01_00135892 predicted 2274
15 SASI_Hs01_00135893 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255369 predicted 1960
2 SASI_Rn02_00255370 predicted 616
3 SASI_Rn02_00255371 predicted 2578
4 SASI_Rn02_00255372 predicted 798
5 SASI_Rn02_00255373 predicted 593
6 SASI_Rn02_00255374 predicted 356
7 SASI_Rn02_00255375 predicted 2975
8 SASI_Rn02_00255376 predicted 1083
9 SASI_Rn02_00255377 predicted 1196
10 SASI_Rn02_00255378 predicted 3139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148875 predicted 3285
2 SASI_Mm01_00148876 predicted 2677
3 SASI_Mm01_00148877 predicted 288
4 SASI_Mm01_00148878 predicted 3231
5 SASI_Mm01_00148879 predicted 2939
6 SASI_Mm02_00338067 predicted 1280
7 SASI_Mm01_00148881 predicted 3298
8 SASI_Mm01_00148882 predicted 1167
9 SASI_Mm01_00148883 predicted 265
10 SASI_Mm01_00148884 predicted 293
11 SASI_Mm01_00148880 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058214
VALIDATED
RECQL4 MISSION shRNA Bacterial Glycerol Stock
RecQ protein-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058214.2-2033s21c1
Sequence:CCGGTTGGCATAGCTGGCGAGTTTGCTCGAGCAAACTCGCCAGCTATGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058214.2-1018s21c1
Sequence:CCGGCTAGACAGAGGGAACTATATTCTCGAGAATATAGTTCCCTCTGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058214.2-2788s21c1
Sequence:CCGGGAGACTCTGCTGTGCTATTTGCTCGAGCAAATAGCACAGCAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_058214.1-1017s1c1
Sequence:CCGGCCTAGACAGAGGGAACTATATCTCGAGATATAGTTCCCTCTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_058214.1-2163s1c1
Sequence:CCGGCCTGGATTCAGTTATCATTTACTCGAGTAAATGATAACTGAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058214
VALIDATED
RECQL4 MISSION shRNA shRNA Plasmid DNA
RecQ protein-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058214.2-2033s21c1
Sequence:CCGGTTGGCATAGCTGGCGAGTTTGCTCGAGCAAACTCGCCAGCTATGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058214.2-1018s21c1
Sequence:CCGGCTAGACAGAGGGAACTATATTCTCGAGAATATAGTTCCCTCTGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058214.2-2788s21c1
Sequence:CCGGGAGACTCTGCTGTGCTATTTGCTCGAGCAAATAGCACAGCAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_058214.1-1017s1c1
Sequence:CCGGCCTAGACAGAGGGAACTATATCTCGAGATATAGTTCCCTCTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_058214.1-2163s1c1
Sequence:CCGGCCTGGATTCAGTTATCATTTACTCGAGTAAATGATAACTGAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058214
VALIDATED
RECQL4 MISSION shRNA Lentiviral Transduction Particles
RecQ protein-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058214.2-2033s21c1
Sequence:CCGGTTGGCATAGCTGGCGAGTTTGCTCGAGCAAACTCGCCAGCTATGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058214.2-1018s21c1
Sequence:CCGGCTAGACAGAGGGAACTATATTCTCGAGAATATAGTTCCCTCTGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058214.2-2788s21c1
Sequence:CCGGGAGACTCTGCTGTGCTATTTGCTCGAGCAAATAGCACAGCAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_058214.1-1017s1c1
Sequence:CCGGCCTAGACAGAGGGAACTATATCTCGAGATATAGTTCCCTCTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_058214.1-2163s1c1
Sequence:CCGGCCTGGATTCAGTTATCATTTACTCGAGTAAATGATAACTGAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004260
RECQL4 MISSION shRNA Bacterial Glycerol Stock
RecQ protein-like 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004260.2-420s21c1
Sequence:CCGGCTAGGAAGAGCCTCATCTAAGCTCGAGCTTAGATGAGGCTCTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004260.2-355s21c1
Sequence:CCGGGGCTCAAGGCCAATCTGAAAGCTCGAGCTTTCAGATTGGCCTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004260.2-2128s21c1
Sequence:CCGGACCTCGATTCCATTATCATTTCTCGAGAAATGATAATGGAATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-1063s1c1
Sequence:CCGGCGGCTCAACATGAAGCAGAAACTCGAGTTTCTGCTTCATGTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-2097s1c1
Sequence:CCGGCCTCGATTCCATTATCATTTACTCGAGTAAATGATAATGGAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-3148s1c1
Sequence:CCGGCAGATATGTGACTTCCTCTATCTCGAGATAGAGGAAGTCACATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-2710s1c1
Sequence:CCGGCTCCCAATACAGCTTACCGTACTCGAGTACGGTAAGCTGTATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-257s1c1
Sequence:CCGGCGACCAAGAGTCCACAGCCTACTCGAGTAGGCTGTGGACTCTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004260
RECQL4 MISSION shRNA shRNA Plasmid DNA
RecQ protein-like 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004260.2-420s21c1
Sequence:CCGGCTAGGAAGAGCCTCATCTAAGCTCGAGCTTAGATGAGGCTCTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004260.2-355s21c1
Sequence:CCGGGGCTCAAGGCCAATCTGAAAGCTCGAGCTTTCAGATTGGCCTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004260.2-2128s21c1
Sequence:CCGGACCTCGATTCCATTATCATTTCTCGAGAAATGATAATGGAATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-1063s1c1
Sequence:CCGGCGGCTCAACATGAAGCAGAAACTCGAGTTTCTGCTTCATGTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-2097s1c1
Sequence:CCGGCCTCGATTCCATTATCATTTACTCGAGTAAATGATAATGGAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-3148s1c1
Sequence:CCGGCAGATATGTGACTTCCTCTATCTCGAGATAGAGGAAGTCACATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-2710s1c1
Sequence:CCGGCTCCCAATACAGCTTACCGTACTCGAGTACGGTAAGCTGTATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-257s1c1
Sequence:CCGGCGACCAAGAGTCCACAGCCTACTCGAGTAGGCTGTGGACTCTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004260
RECQL4 MISSION shRNA Lentiviral Transduction Particles
RecQ protein-like 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004260.2-420s21c1
Sequence:CCGGCTAGGAAGAGCCTCATCTAAGCTCGAGCTTAGATGAGGCTCTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004260.2-355s21c1
Sequence:CCGGGGCTCAAGGCCAATCTGAAAGCTCGAGCTTTCAGATTGGCCTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004260.2-2128s21c1
Sequence:CCGGACCTCGATTCCATTATCATTTCTCGAGAAATGATAATGGAATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-1063s1c1
Sequence:CCGGCGGCTCAACATGAAGCAGAAACTCGAGTTTCTGCTTCATGTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-2097s1c1
Sequence:CCGGCCTCGATTCCATTATCATTTACTCGAGTAAATGATAATGGAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-3148s1c1
Sequence:CCGGCAGATATGTGACTTCCTCTATCTCGAGATAGAGGAAGTCACATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-2710s1c1
Sequence:CCGGCTCCCAATACAGCTTACCGTACTCGAGTACGGTAAGCTGTATTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004260.1-257s1c1
Sequence:CCGGCGACCAAGAGTCCACAGCCTACTCGAGTAGGCTGTGGACTCTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks