EMAIL THIS PAGE TO A FRIEND

REEP1

receptor accessory protein 1

Synonyms: C2orf23 HMN5B SPG31
UniProtKB ID: Q9H902, B7Z4D7, B7Z4F2, B7Z5R9, D6W5M2, Q53TI0
Gene ID:
Human(65055) Summary: This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(52250) receptor accessory protein 1
Rat(362384) receptor accessory protein 1
chicken(771776) receptor accessory protein 1
domestic cat(101092349) receptor accessory protein 1
dog(613003) receptor accessory protein 1
cow(616916) receptor accessory protein 1
sheep(101103225) receptor accessory protein 1
domestic guinea pig(100727768) receptor accessory protein 1
naked mole-rat(101724993) receptor accessory protein 1
198 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101977 Anti-REEP1 (ab2) antibody produced in rabbit affinity isolated antibody human, horse, rabbit, canine, bovine, mouse, rat, guinea pig
western blot pricing
SAB2108204 Anti-REEP1 antibody produced in rabbit affinity isolated antibody rat, guinea pig, human, rabbit, canine, bovine, mouse, zebrafish, horse
western blot pricing
HPA058061 Anti-REEP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022912 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022912 Rosetta Predictions human pricing
NM_001108633 Rosetta Predictions rat pricing
NM_178608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356226 predicted 407
2 SASI_Hs01_00036656 predicted 452
3 SASI_Hs01_00036658 predicted 176
4 SASI_Hs01_00036660 predicted 308
5 SASI_Hs01_00036661 predicted 794
6 SASI_Hs01_00036663 predicted 326
7 SASI_Hs01_00036664 predicted 675
8 SASI_Hs01_00036665 predicted 329
9 SASI_Hs02_00356227 predicted 189
10 SASI_Hs01_00036659 predicted 328
11 SASI_Hs01_00036657 predicted 1233
12 SASI_Hs01_00036662 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240549 predicted 225
2 SASI_Rn02_00240550 predicted 1229
3 SASI_Rn02_00240551 predicted 300
4 SASI_Rn02_00240552 predicted 220
5 SASI_Rn02_00240553 predicted 1242
6 SASI_Rn02_00240554 predicted 320
7 SASI_Rn02_00240555 predicted 1196
8 SASI_Rn02_00240556 predicted 315
9 SASI_Rn02_00240557 predicted 220
10 SASI_Rn02_00240558 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109912 predicted 1036
2 SASI_Mm01_00109913 predicted 283
3 SASI_Mm01_00109914 predicted 215
4 SASI_Mm02_00348958 predicted 905
5 SASI_Mm01_00109915 predicted 1102
6 SASI_Mm01_00109916 predicted 296
7 SASI_Mm01_00109917 predicted 1200
8 SASI_Mm01_00109918 predicted 444
9 SASI_Mm01_00109919 predicted 1089
10 SASI_Mm01_00109920 predicted 1204
11 SASI_Mm01_00109921 predicted 933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022912
VALIDATED
REEP1 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022912.2-414s21c1
Sequence:CCGGGTTTGTACATCCCACGCTATCCTCGAGGATAGCGTGGGATGTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022912.2-190s21c1
Sequence:CCGGACCCTTTACCCTGCGTATTATCTCGAGATAATACGCAGGGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022912.2-1220s21c1
Sequence:CCGGTCTTTGTTCTTGGTACTTATACTCGAGTATAAGTACCAAGAACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022912.2-256s21c1
Sequence:CCGGTGGATGATGTACTGGATTATACTCGAGTATAATCCAGTACATCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022912.2-743s21c1
Sequence:CCGGCCGCCTAGAATCCTTCGATCTCTCGAGAGATCGAAGGATTCTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022912.2-223s21c1
Sequence:CCGGGTGAAATCAAAGGACATTAAGCTCGAGCTTAATGTCCTTTGATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022912.2-1071s21c1
Sequence:CCGGCACAATTGGATTGTCATTATACTCGAGTATAATGACAATCCAATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-319s1c1
Sequence:CCGGCTTTGTTGGTTTCCATTCTATCTCGAGATAGAATGGAAACCAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-198s1c1
Sequence:CCGGCCCTGCGTATTATTCCTACAACTCGAGTTGTAGGAATAATACGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-177s1c1
Sequence:CCGGGCTTATATTTGGCACCCTTTACTCGAGTAAAGGGTGCCAAATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-310s1c1
Sequence:CCGGGACATCTTCCTTTGTTGGTTTCTCGAGAAACCAACAAAGGAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-413s1c1
Sequence:CCGGAGTTTGTACATCCCACACTATCTCGAGATAGTGTGGGATGTACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022912
VALIDATED
REEP1 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022912.2-414s21c1
Sequence:CCGGGTTTGTACATCCCACGCTATCCTCGAGGATAGCGTGGGATGTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022912.2-190s21c1
Sequence:CCGGACCCTTTACCCTGCGTATTATCTCGAGATAATACGCAGGGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022912.2-1220s21c1
Sequence:CCGGTCTTTGTTCTTGGTACTTATACTCGAGTATAAGTACCAAGAACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022912.2-256s21c1
Sequence:CCGGTGGATGATGTACTGGATTATACTCGAGTATAATCCAGTACATCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022912.2-743s21c1
Sequence:CCGGCCGCCTAGAATCCTTCGATCTCTCGAGAGATCGAAGGATTCTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022912.2-223s21c1
Sequence:CCGGGTGAAATCAAAGGACATTAAGCTCGAGCTTAATGTCCTTTGATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022912.2-1071s21c1
Sequence:CCGGCACAATTGGATTGTCATTATACTCGAGTATAATGACAATCCAATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-319s1c1
Sequence:CCGGCTTTGTTGGTTTCCATTCTATCTCGAGATAGAATGGAAACCAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-198s1c1
Sequence:CCGGCCCTGCGTATTATTCCTACAACTCGAGTTGTAGGAATAATACGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-177s1c1
Sequence:CCGGGCTTATATTTGGCACCCTTTACTCGAGTAAAGGGTGCCAAATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-310s1c1
Sequence:CCGGGACATCTTCCTTTGTTGGTTTCTCGAGAAACCAACAAAGGAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-413s1c1
Sequence:CCGGAGTTTGTACATCCCACACTATCTCGAGATAGTGTGGGATGTACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022912
VALIDATED
REEP1 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022912.2-414s21c1
Sequence:CCGGGTTTGTACATCCCACGCTATCCTCGAGGATAGCGTGGGATGTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022912.2-190s21c1
Sequence:CCGGACCCTTTACCCTGCGTATTATCTCGAGATAATACGCAGGGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022912.2-1220s21c1
Sequence:CCGGTCTTTGTTCTTGGTACTTATACTCGAGTATAAGTACCAAGAACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022912.2-256s21c1
Sequence:CCGGTGGATGATGTACTGGATTATACTCGAGTATAATCCAGTACATCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022912.2-743s21c1
Sequence:CCGGCCGCCTAGAATCCTTCGATCTCTCGAGAGATCGAAGGATTCTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022912.2-223s21c1
Sequence:CCGGGTGAAATCAAAGGACATTAAGCTCGAGCTTAATGTCCTTTGATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022912.2-1071s21c1
Sequence:CCGGCACAATTGGATTGTCATTATACTCGAGTATAATGACAATCCAATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-319s1c1
Sequence:CCGGCTTTGTTGGTTTCCATTCTATCTCGAGATAGAATGGAAACCAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-198s1c1
Sequence:CCGGCCCTGCGTATTATTCCTACAACTCGAGTTGTAGGAATAATACGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-177s1c1
Sequence:CCGGGCTTATATTTGGCACCCTTTACTCGAGTAAAGGGTGCCAAATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-310s1c1
Sequence:CCGGGACATCTTCCTTTGTTGGTTTCTCGAGAAACCAACAAAGGAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022912.1-413s1c1
Sequence:CCGGAGTTTGTACATCCCACACTATCTCGAGATAGTGTGGGATGTACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178608
VALIDATED
REEP1 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178608.3-2227s21c1
Sequence:CCGGGCTAGAGAAATAGTGTTGTATCTCGAGATACAACACTATTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178608.3-230s21c1
Sequence:CCGGGTATTGGATTATATTTGCCCTCTCGAGAGGGCAAATATAATCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178608.3-2666s21c1
Sequence:CCGGCCCGAAATAATAAATGGCTTTCTCGAGAAAGCCATTTATTATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178608.3-186s21c1
Sequence:CCGGGCTGTGAAGTCCAAGGACATTCTCGAGAATGTCCTTGGACTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178608.2-231s1c1
Sequence:CCGGGTATTGGATTATATTTGCCCTCTCGAGAGGGCAAATATAATCCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178608.2-2228s1c1
Sequence:CCGGGCTAGAGAAATAGTGTTGTATCTCGAGATACAACACTATTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178608.2-187s1c1
Sequence:CCGGGCTGTGAAGTCCAAGGACATTCTCGAGAATGTCCTTGGACTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178608.2-2667s1c1
Sequence:CCGGCCCGAAATAATAAATGGCTTTCTCGAGAAAGCCATTTATTATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178608
VALIDATED
REEP1 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178608.3-2227s21c1
Sequence:CCGGGCTAGAGAAATAGTGTTGTATCTCGAGATACAACACTATTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178608.3-230s21c1
Sequence:CCGGGTATTGGATTATATTTGCCCTCTCGAGAGGGCAAATATAATCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178608.3-2666s21c1
Sequence:CCGGCCCGAAATAATAAATGGCTTTCTCGAGAAAGCCATTTATTATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178608.3-186s21c1
Sequence:CCGGGCTGTGAAGTCCAAGGACATTCTCGAGAATGTCCTTGGACTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178608.2-231s1c1
Sequence:CCGGGTATTGGATTATATTTGCCCTCTCGAGAGGGCAAATATAATCCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178608.2-2228s1c1
Sequence:CCGGGCTAGAGAAATAGTGTTGTATCTCGAGATACAACACTATTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178608.2-187s1c1
Sequence:CCGGGCTGTGAAGTCCAAGGACATTCTCGAGAATGTCCTTGGACTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178608.2-2667s1c1
Sequence:CCGGCCCGAAATAATAAATGGCTTTCTCGAGAAAGCCATTTATTATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178608
VALIDATED
REEP1 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178608.3-2227s21c1
Sequence:CCGGGCTAGAGAAATAGTGTTGTATCTCGAGATACAACACTATTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178608.3-230s21c1
Sequence:CCGGGTATTGGATTATATTTGCCCTCTCGAGAGGGCAAATATAATCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178608.3-2666s21c1
Sequence:CCGGCCCGAAATAATAAATGGCTTTCTCGAGAAAGCCATTTATTATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178608.3-186s21c1
Sequence:CCGGGCTGTGAAGTCCAAGGACATTCTCGAGAATGTCCTTGGACTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178608.2-231s1c1
Sequence:CCGGGTATTGGATTATATTTGCCCTCTCGAGAGGGCAAATATAATCCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178608.2-2228s1c1
Sequence:CCGGGCTAGAGAAATAGTGTTGTATCTCGAGATACAACACTATTTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178608.2-187s1c1
Sequence:CCGGGCTGTGAAGTCCAAGGACATTCTCGAGAATGTCCTTGGACTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178608.2-2667s1c1
Sequence:CCGGCCCGAAATAATAAATGGCTTTCTCGAGAAAGCCATTTATTATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks