EMAIL THIS PAGE TO A FRIEND

REEP3

receptor accessory protein 3

Synonyms: C10orf74
UniProtKB ID: Q6NUK4, Q5JQR5, Q5QGT2, Q6PEW8, Q6PJY4
Gene ID:
Mouse(28193) receptor accessory protein 3
Rat(294375) receptor accessory protein 3
Zebrafish(393130) receptor accessory protein 3
domestic cat(101085577) receptor accessory protein 3
dog(479222) receptor accessory protein 3
chicken(423654) receptor accessory protein 3
cow(512704) receptor accessory protein 3
Goat(100861108) receptor accessory protein 3
sheep(101122325) receptor accessory protein 3
domestic guinea pig(100715056) receptor accessory protein 3
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103324 Anti-REEP3 (226-240) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB3500135 Anti-REEP3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900870 Anti-REEP3 antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001330 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001330 Rosetta Predictions human pricing
NM_001106386 Rosetta Predictions rat pricing
NM_178606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116109 predicted 554
2 SASI_Hs01_00116110 predicted 802
3 SASI_Hs01_00116111 predicted 683
4 SASI_Hs01_00116112 predicted 420
5 SASI_Hs01_00116113 predicted 840
6 SASI_Hs01_00116114 predicted 228
7 SASI_Hs01_00116115 predicted 613
8 SASI_Hs01_00116116 predicted 536
9 SASI_Hs01_00116117 predicted 740
10 SASI_Hs01_00116118 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218458 predicted 951
2 SASI_Rn02_00218459 predicted 991
3 SASI_Rn02_00218460 predicted 673
4 SASI_Rn02_00218461 predicted 869
5 SASI_Rn02_00218462 predicted 1046
6 SASI_Rn02_00218463 predicted 555
7 SASI_Rn02_00218464 predicted 621
8 SASI_Rn02_00218465 predicted 897
9 SASI_Rn02_00218466 predicted 456
10 SASI_Rn02_00218467 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348947 predicted 874
2 SASI_Mm02_00348948 predicted 991
3 SASI_Mm02_00348949 predicted 593
4 SASI_Mm02_00348950 predicted 773
5 SASI_Mm02_00348951 predicted 911
6 SASI_Mm02_00348952 predicted 922
7 SASI_Mm02_00348953 predicted 340
8 SASI_Mm02_00348954 predicted 835
9 SASI_Mm02_00348955 predicted 819
10 SASI_Mm02_00348956 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178606
VALIDATED
REEP3 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178606.4-140s21c1
Sequence:CCGGACGTTCGCTGGATGATGTATTCTCGAGAATACATCATCCAGCGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178606.4-914s21c1
Sequence:CCGGGGGATTTACGCAATGACTTTACTCGAGTAAAGTCATTGCGTAAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178606.4-83s21c1
Sequence:CCGGTGCTCTATCCAGCGTACTATTCTCGAGAATAGTACGCTGGATAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178606.4-378s21c1
Sequence:CCGGCTATGAGACAATGGTGAATTTCTCGAGAAATTCACCATTGTCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178606.2-2172s1c1
Sequence:CCGGCCCAGCAATGACTAACATCTTCTCGAGAAGATGTTAGTCATTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178606.2-864s1c1
Sequence:CCGGCCTGATGTATTCAGGGCTTAACTCGAGTTAAGCCCTGAATACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178606.2-712s1c1
Sequence:CCGGGAAATCTGTCAAGACCATCAACTCGAGTTGATGGTCTTGACAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178606.2-226s1c1
Sequence:CCGGCCTGTACTATGAGCTGAAGATCTCGAGATCTTCAGCTCATAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178606
VALIDATED
REEP3 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178606.4-140s21c1
Sequence:CCGGACGTTCGCTGGATGATGTATTCTCGAGAATACATCATCCAGCGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178606.4-914s21c1
Sequence:CCGGGGGATTTACGCAATGACTTTACTCGAGTAAAGTCATTGCGTAAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178606.4-83s21c1
Sequence:CCGGTGCTCTATCCAGCGTACTATTCTCGAGAATAGTACGCTGGATAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178606.4-378s21c1
Sequence:CCGGCTATGAGACAATGGTGAATTTCTCGAGAAATTCACCATTGTCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178606.2-2172s1c1
Sequence:CCGGCCCAGCAATGACTAACATCTTCTCGAGAAGATGTTAGTCATTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178606.2-864s1c1
Sequence:CCGGCCTGATGTATTCAGGGCTTAACTCGAGTTAAGCCCTGAATACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178606.2-712s1c1
Sequence:CCGGGAAATCTGTCAAGACCATCAACTCGAGTTGATGGTCTTGACAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178606.2-226s1c1
Sequence:CCGGCCTGTACTATGAGCTGAAGATCTCGAGATCTTCAGCTCATAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178606
VALIDATED
REEP3 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178606.4-140s21c1
Sequence:CCGGACGTTCGCTGGATGATGTATTCTCGAGAATACATCATCCAGCGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178606.4-914s21c1
Sequence:CCGGGGGATTTACGCAATGACTTTACTCGAGTAAAGTCATTGCGTAAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178606.4-83s21c1
Sequence:CCGGTGCTCTATCCAGCGTACTATTCTCGAGAATAGTACGCTGGATAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178606.4-378s21c1
Sequence:CCGGCTATGAGACAATGGTGAATTTCTCGAGAAATTCACCATTGTCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178606.2-2172s1c1
Sequence:CCGGCCCAGCAATGACTAACATCTTCTCGAGAAGATGTTAGTCATTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178606.2-864s1c1
Sequence:CCGGCCTGATGTATTCAGGGCTTAACTCGAGTTAAGCCCTGAATACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178606.2-712s1c1
Sequence:CCGGGAAATCTGTCAAGACCATCAACTCGAGTTGATGGTCTTGACAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178606.2-226s1c1
Sequence:CCGGCCTGTACTATGAGCTGAAGATCTCGAGATCTTCAGCTCATAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001330
VALIDATED
REEP3 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-688s1c1
Sequence:CCGGCCATACCAACCTCTACCAGAACTCGAGTTCTGGTAGAGGTTGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-550s1c1
Sequence:CCGGCGGCAAGGTTTAAACCTTGCACTCGAGTGCAAGGTTTAAACCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-331s1c1
Sequence:CCGGGTGATTGAAACAGTAGCCGATCTCGAGATCGGCTACTGTTTCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001330.1-279s1c1
Sequence:CCGGGAAGGAATATGTTCGATGGATCTCGAGATCCATCGAACATATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-840s1c1
Sequence:CCGGGCTTCGAAGATCGCAAAGCATCTCGAGATGCTTTGCGATCTTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001330
VALIDATED
REEP3 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-688s1c1
Sequence:CCGGCCATACCAACCTCTACCAGAACTCGAGTTCTGGTAGAGGTTGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-550s1c1
Sequence:CCGGCGGCAAGGTTTAAACCTTGCACTCGAGTGCAAGGTTTAAACCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-331s1c1
Sequence:CCGGGTGATTGAAACAGTAGCCGATCTCGAGATCGGCTACTGTTTCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001330.1-279s1c1
Sequence:CCGGGAAGGAATATGTTCGATGGATCTCGAGATCCATCGAACATATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-840s1c1
Sequence:CCGGGCTTCGAAGATCGCAAAGCATCTCGAGATGCTTTGCGATCTTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001330
VALIDATED
REEP3 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-688s1c1
Sequence:CCGGCCATACCAACCTCTACCAGAACTCGAGTTCTGGTAGAGGTTGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-550s1c1
Sequence:CCGGCGGCAAGGTTTAAACCTTGCACTCGAGTGCAAGGTTTAAACCTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-331s1c1
Sequence:CCGGGTGATTGAAACAGTAGCCGATCTCGAGATCGGCTACTGTTTCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001330.1-279s1c1
Sequence:CCGGGAAGGAATATGTTCGATGGATCTCGAGATCCATCGAACATATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001001330.1-840s1c1
Sequence:CCGGGCTTCGAAGATCGCAAAGCATCTCGAGATGCTTTGCGATCTTCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks