EMAIL THIS PAGE TO A FRIEND

REG4

regenerating islet-derived family, member 4

Synonyms: GISP REG-IV RELP
UniProtKB ID: Q9BYZ8, Q8NER6, Q8NER7
Gene ID:
Mouse(67709) regenerating islet-derived family, member 4
Rat(445583) regenerating islet-derived family, member 4
chicken(424379) regenerating islet-derived family, member 4
domestic cat(101091547) regenerating islet-derived family, member 4
domestic guinea pig(100727547) regenerating islet-derived family, member 4
cow(767907) regenerating islet-derived family, member 4
sheep(101111843) regenerating islet-derived family, member 4
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1661 Human Reg4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032044 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082771 MISSION® esiRNA esiRNA human REG4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032044 Rosetta Predictions human pricing
NM_001004096 Rosetta Predictions rat pricing
NM_026328 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359245 predicted 646
2 SASI_Hs01_00101947 predicted 650
3 SASI_Hs01_00101948 predicted 465
4 SASI_Hs01_00101950 predicted 497
5 SASI_Hs01_00101952 predicted 462
6 SASI_Hs01_00101953 predicted 903
7 SASI_Hs01_00101954 predicted 493
8 SASI_Hs02_00359246 predicted 915
9 SASI_Hs01_00101955 predicted 271
10 SASI_Hs01_00101956 predicted 990
11 SASI_Hs01_00101949 predicted 886
12 SASI_Hs01_00101951 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091887 predicted 222
2 SASI_Rn01_00091888 predicted 216
3 SASI_Rn01_00091889 predicted 222
4 SASI_Rn01_00091890 predicted 221
5 SASI_Rn01_00091891 predicted 211
6 SASI_Rn01_00091892 predicted 215
7 SASI_Rn01_00091893 predicted 232
8 SASI_Rn01_00091894 predicted 224
9 SASI_Rn01_00091895 predicted 220
10 SASI_Rn01_00091896 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105222 predicted 481
2 SASI_Mm01_00105223 predicted 389
3 SASI_Mm01_00105224 predicted 762
4 SASI_Mm01_00105225 predicted 679
5 SASI_Mm02_00330040 predicted 333
6 SASI_Mm01_00105226 predicted 352
7 SASI_Mm01_00105227 predicted 626
8 SASI_Mm01_00105228 predicted 616
9 SASI_Mm02_00330041 predicted 535
10 SASI_Mm01_00105229 predicted 591
11 SASI_Mm01_00105221 predicted 575
12 SASI_Mm01_00105230 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026328
REG4 MISSION shRNA Bacterial Glycerol Stock
regenerating islet-derived family, member 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-220s21c1
Sequence:CCGGCCGAAGTCCTGAGCGATATCTCTCGAGAGATATCGCTCAGGACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026328.1-694s21c1
Sequence:CCGGCACCTGGTGGCTGATCTAATCCTCGAGGATTAGATCAGCCACCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-394s21c1
Sequence:CCGGGTGTCATATCAAAGTACATAACTCGAGTTATGTACTTTGATATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-614s21c1
Sequence:CCGGACACTTCCTGTGCAAGTATAACTCGAGTTATACTTGCACAGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-483s21c1
Sequence:CCGGTGGACTGATGGGTCTACAAACCTCGAGGTTTGTAGACCCATCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026328.1-392s1c1
Sequence:CCGGCAGTGTCATATCAAAGTACATCTCGAGATGTACTTTGATATGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026328.1-611s1c1
Sequence:CCGGCCAACACTTCCTGTGCAAGTACTCGAGTACTTGCACAGGAAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026328
REG4 MISSION shRNA shRNA Plasmid DNA
regenerating islet-derived family, member 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-220s21c1
Sequence:CCGGCCGAAGTCCTGAGCGATATCTCTCGAGAGATATCGCTCAGGACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026328.1-694s21c1
Sequence:CCGGCACCTGGTGGCTGATCTAATCCTCGAGGATTAGATCAGCCACCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-394s21c1
Sequence:CCGGGTGTCATATCAAAGTACATAACTCGAGTTATGTACTTTGATATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-614s21c1
Sequence:CCGGACACTTCCTGTGCAAGTATAACTCGAGTTATACTTGCACAGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-483s21c1
Sequence:CCGGTGGACTGATGGGTCTACAAACCTCGAGGTTTGTAGACCCATCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026328.1-392s1c1
Sequence:CCGGCAGTGTCATATCAAAGTACATCTCGAGATGTACTTTGATATGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026328.1-611s1c1
Sequence:CCGGCCAACACTTCCTGTGCAAGTACTCGAGTACTTGCACAGGAAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026328
REG4 MISSION shRNA Lentiviral Transduction Particles
regenerating islet-derived family, member 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-220s21c1
Sequence:CCGGCCGAAGTCCTGAGCGATATCTCTCGAGAGATATCGCTCAGGACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026328.1-694s21c1
Sequence:CCGGCACCTGGTGGCTGATCTAATCCTCGAGGATTAGATCAGCCACCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-394s21c1
Sequence:CCGGGTGTCATATCAAAGTACATAACTCGAGTTATGTACTTTGATATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-614s21c1
Sequence:CCGGACACTTCCTGTGCAAGTATAACTCGAGTTATACTTGCACAGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026328.1-483s21c1
Sequence:CCGGTGGACTGATGGGTCTACAAACCTCGAGGTTTGTAGACCCATCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026328.1-392s1c1
Sequence:CCGGCAGTGTCATATCAAAGTACATCTCGAGATGTACTTTGATATGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026328.1-611s1c1
Sequence:CCGGCCAACACTTCCTGTGCAAGTACTCGAGTACTTGCACAGGAAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032044
REG4 MISSION shRNA Bacterial Glycerol Stock
regenerating islet-derived family, member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-659s1c1
Sequence:CCGGGATGAGCTCCAATAACAACTTCTCGAGAAGTTGTTATTGGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-745s1c1
Sequence:CCGGGCAAGAATCAAGATTCTGCTACTCGAGTAGCAGAATCTTGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-641s1c1
Sequence:CCGGGAACAAGCACTGTGCTGAGATCTCGAGATCTCAGCACAGTGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-689s1c1
Sequence:CCGGGAGCAGCAACGAATGCAACAACTCGAGTTGTTGCATTCGTTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-714s1c1
Sequence:CCGGCAACACTTCCTGTGCAAGTACCTCGAGGTACTTGCACAGGAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-1028s1c1
Sequence:CCGGCCTATGAAACAGCTGGGTCTTCTCGAGAAGACCCAGCTGTTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-837s1c1
Sequence:CCGGCCTAGCAAACTAAGAGTGATACTCGAGTATCACTCTTAGTTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032044.2-504s1c1
Sequence:CCGGGCAGAGTACATAAGTGGCTATCTCGAGATAGCCACTTATGTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-802s1c1
Sequence:CCGGCCTGGCTAAATCTGCTCATTACTCGAGTAATGAGCAGATTTAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032044
REG4 MISSION shRNA shRNA Plasmid DNA
regenerating islet-derived family, member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-659s1c1
Sequence:CCGGGATGAGCTCCAATAACAACTTCTCGAGAAGTTGTTATTGGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-745s1c1
Sequence:CCGGGCAAGAATCAAGATTCTGCTACTCGAGTAGCAGAATCTTGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-641s1c1
Sequence:CCGGGAACAAGCACTGTGCTGAGATCTCGAGATCTCAGCACAGTGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-689s1c1
Sequence:CCGGGAGCAGCAACGAATGCAACAACTCGAGTTGTTGCATTCGTTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-714s1c1
Sequence:CCGGCAACACTTCCTGTGCAAGTACCTCGAGGTACTTGCACAGGAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-1028s1c1
Sequence:CCGGCCTATGAAACAGCTGGGTCTTCTCGAGAAGACCCAGCTGTTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-837s1c1
Sequence:CCGGCCTAGCAAACTAAGAGTGATACTCGAGTATCACTCTTAGTTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032044.2-504s1c1
Sequence:CCGGGCAGAGTACATAAGTGGCTATCTCGAGATAGCCACTTATGTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-802s1c1
Sequence:CCGGCCTGGCTAAATCTGCTCATTACTCGAGTAATGAGCAGATTTAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032044
REG4 MISSION shRNA Lentiviral Transduction Particles
regenerating islet-derived family, member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-659s1c1
Sequence:CCGGGATGAGCTCCAATAACAACTTCTCGAGAAGTTGTTATTGGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-745s1c1
Sequence:CCGGGCAAGAATCAAGATTCTGCTACTCGAGTAGCAGAATCTTGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-641s1c1
Sequence:CCGGGAACAAGCACTGTGCTGAGATCTCGAGATCTCAGCACAGTGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-689s1c1
Sequence:CCGGGAGCAGCAACGAATGCAACAACTCGAGTTGTTGCATTCGTTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032044.2-714s1c1
Sequence:CCGGCAACACTTCCTGTGCAAGTACCTCGAGGTACTTGCACAGGAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-1028s1c1
Sequence:CCGGCCTATGAAACAGCTGGGTCTTCTCGAGAAGACCCAGCTGTTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-837s1c1
Sequence:CCGGCCTAGCAAACTAAGAGTGATACTCGAGTATCACTCTTAGTTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032044.2-504s1c1
Sequence:CCGGGCAGAGTACATAAGTGGCTATCTCGAGATAGCCACTTATGTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032044.2-802s1c1
Sequence:CCGGCCTGGCTAAATCTGCTCATTACTCGAGTAATGAGCAGATTTAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks