EMAIL THIS PAGE TO A FRIEND

RELN

reelin

Synonyms: LIS2 PRO1598 RL
Gene ID:
Human(5649) Summary: This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(19699) reelin
Rat(24718) reelin
dog(483273) reelin
cow(281450) reelin-like
157 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005045 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005045 Rosetta Predictions human pricing
NM_173054 Rosetta Predictions human pricing
NM_080394 Rosetta Predictions rat pricing
NM_011261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072680 predicted 5192
2 SASI_Hs01_00072681 predicted 9811
3 SASI_Hs01_00072682 predicted 9318
4 SASI_Hs01_00072683 predicted 9384
5 SASI_Hs01_00072684 predicted 4860
6 SASI_Hs01_00072685 predicted 7423
7 SASI_Hs01_00072686 predicted 2133
8 SASI_Hs01_00072687 predicted 8634
9 SASI_Hs02_00338844 predicted 4251
10 SASI_Hs01_00072689 predicted 4494
11 SASI_Hs01_00072688 predicted 1809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129186 predicted 5197
2 SASI_Hs01_00129187 predicted 9812
3 SASI_Hs01_00129188 predicted 9319
4 SASI_Hs01_00129189 predicted 9380
5 SASI_Hs01_00129190 predicted 4853
6 SASI_Hs02_00368042 predicted 6190
7 SASI_Hs01_00129191 predicted 7417
8 SASI_Hs01_00129192 predicted 2133
9 SASI_Hs01_00129193 predicted 8630
10 SASI_Hs02_00368043 predicted 4248
11 SASI_Hs01_00129194 predicted 1807
12 SASI_Hs01_00129195 predicted 4496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092514 predicted 4251
2 SASI_Rn02_00267204 predicted 7884
3 SASI_Rn01_00092515 predicted 8984
4 SASI_Rn01_00092517 predicted 5963
5 SASI_Rn01_00092518 predicted 6203
6 SASI_Rn01_00092519 predicted 5659
7 SASI_Rn01_00092521 predicted 3090
8 SASI_Rn01_00092522 predicted 3914
9 SASI_Rn02_00267205 predicted 8292
10 SASI_Rn01_00092523 predicted 1724
11 SASI_Rn01_00092516 predicted 6120
12 SASI_Rn01_00092520 predicted 4069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097065 predicted 5551
2 SASI_Mm01_00097067 predicted 5785
3 SASI_Mm01_00097068 predicted 6327
4 SASI_Mm01_00097070 predicted 10527
5 SASI_Mm01_00097071 predicted 5999
6 SASI_Mm01_00097072 predicted 8668
7 SASI_Mm01_00097073 predicted 7385
8 SASI_Mm01_00097074 predicted 2421
9 SASI_Mm02_00320265 predicted 4391
10 SASI_Mm02_00320266 predicted 4060
11 SASI_Mm01_00097066 predicted 6076
12 SASI_Mm01_00097069 predicted 9098
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011261
RELN MISSION shRNA Bacterial Glycerol Stock
reelin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011261.2-9065s21c1
Sequence:CCGGCCGAGAACACTGCACTCTATTCTCGAGAATAGAGTGCAGTGTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011261.2-4365s21c1
Sequence:CCGGTGAGCCTACTGTCTATTATACCTCGAGGTATAATAGACAGTAGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011261.2-1106s21c1
Sequence:CCGGGGTCAGGATCATGTCGATTTACTCGAGTAAATCGACATGATCCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011261.2-11037s21c1
Sequence:CCGGTGTTGGTCACCGAGCTATTTACTCGAGTAAATAGCTCGGTGACCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011261.1-10880s1c1
Sequence:CCGGCCGTGGAAATTGTGATCTGTTCTCGAGAACAGATCACAATTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-10471s1c1
Sequence:CCGGGCTCGGATGAAAGGAGTTCTACTCGAGTAGAACTCCTTTCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-6070s1c1
Sequence:CCGGCCGTACAATAATGGTAAGAAACTCGAGTTTCTTACCATTATTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-3096s1c1
Sequence:CCGGCCAGAAATACACTCCTCACATCTCGAGATGTGAGGAGTGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-9631s1c1
Sequence:CCGGCCAGGATACATGATGCAATTTCTCGAGAAATTGCATCATGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011261
RELN MISSION shRNA shRNA Plasmid DNA
reelin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011261.2-9065s21c1
Sequence:CCGGCCGAGAACACTGCACTCTATTCTCGAGAATAGAGTGCAGTGTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011261.2-4365s21c1
Sequence:CCGGTGAGCCTACTGTCTATTATACCTCGAGGTATAATAGACAGTAGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011261.2-1106s21c1
Sequence:CCGGGGTCAGGATCATGTCGATTTACTCGAGTAAATCGACATGATCCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011261.2-11037s21c1
Sequence:CCGGTGTTGGTCACCGAGCTATTTACTCGAGTAAATAGCTCGGTGACCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011261.1-10880s1c1
Sequence:CCGGCCGTGGAAATTGTGATCTGTTCTCGAGAACAGATCACAATTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-10471s1c1
Sequence:CCGGGCTCGGATGAAAGGAGTTCTACTCGAGTAGAACTCCTTTCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-6070s1c1
Sequence:CCGGCCGTACAATAATGGTAAGAAACTCGAGTTTCTTACCATTATTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-3096s1c1
Sequence:CCGGCCAGAAATACACTCCTCACATCTCGAGATGTGAGGAGTGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-9631s1c1
Sequence:CCGGCCAGGATACATGATGCAATTTCTCGAGAAATTGCATCATGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011261
RELN MISSION shRNA Lentiviral Transduction Particles
reelin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011261.2-9065s21c1
Sequence:CCGGCCGAGAACACTGCACTCTATTCTCGAGAATAGAGTGCAGTGTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011261.2-4365s21c1
Sequence:CCGGTGAGCCTACTGTCTATTATACCTCGAGGTATAATAGACAGTAGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011261.2-1106s21c1
Sequence:CCGGGGTCAGGATCATGTCGATTTACTCGAGTAAATCGACATGATCCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011261.2-11037s21c1
Sequence:CCGGTGTTGGTCACCGAGCTATTTACTCGAGTAAATAGCTCGGTGACCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011261.1-10880s1c1
Sequence:CCGGCCGTGGAAATTGTGATCTGTTCTCGAGAACAGATCACAATTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-10471s1c1
Sequence:CCGGGCTCGGATGAAAGGAGTTCTACTCGAGTAGAACTCCTTTCATCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-6070s1c1
Sequence:CCGGCCGTACAATAATGGTAAGAAACTCGAGTTTCTTACCATTATTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-3096s1c1
Sequence:CCGGCCAGAAATACACTCCTCACATCTCGAGATGTGAGGAGTGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011261.1-9631s1c1
Sequence:CCGGCCAGGATACATGATGCAATTTCTCGAGAAATTGCATCATGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005045
RELN MISSION shRNA Bacterial Glycerol Stock
reelin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-997s1c1
Sequence:CCGGCCCAGCATCATCGTGTTATATCTCGAGATATAACACGATGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-5312s1c1
Sequence:CCGGCCTCGGAAAGATTCCAGAATTCTCGAGAATTCTGGAATCTTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-10345s1c1
Sequence:CCGGGCACGGATGAAAGGAGTCTTACTCGAGTAAGACTCCTTTCATCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-9505s1c1
Sequence:CCGGCCAGGATACATGATGCAGTTTCTCGAGAAACTGCATCATGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-2620s1c1
Sequence:CCGGCCCAGAATAATCTCCGTAGAACTCGAGTTCTACGGAGATTATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005045
RELN MISSION shRNA shRNA Plasmid DNA
reelin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-997s1c1
Sequence:CCGGCCCAGCATCATCGTGTTATATCTCGAGATATAACACGATGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-5312s1c1
Sequence:CCGGCCTCGGAAAGATTCCAGAATTCTCGAGAATTCTGGAATCTTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-10345s1c1
Sequence:CCGGGCACGGATGAAAGGAGTCTTACTCGAGTAAGACTCCTTTCATCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-9505s1c1
Sequence:CCGGCCAGGATACATGATGCAGTTTCTCGAGAAACTGCATCATGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-2620s1c1
Sequence:CCGGCCCAGAATAATCTCCGTAGAACTCGAGTTCTACGGAGATTATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005045
RELN MISSION shRNA Lentiviral Transduction Particles
reelin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-997s1c1
Sequence:CCGGCCCAGCATCATCGTGTTATATCTCGAGATATAACACGATGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-5312s1c1
Sequence:CCGGCCTCGGAAAGATTCCAGAATTCTCGAGAATTCTGGAATCTTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-10345s1c1
Sequence:CCGGGCACGGATGAAAGGAGTCTTACTCGAGTAAGACTCCTTTCATCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-9505s1c1
Sequence:CCGGCCAGGATACATGATGCAGTTTCTCGAGAAACTGCATCATGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005045.2-2620s1c1
Sequence:CCGGCCCAGAATAATCTCCGTAGAACTCGAGTTCTACGGAGATTATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks