EMAIL THIS PAGE TO A FRIEND

REM1

RAS (RAD and GEM)-like GTP-binding 1

Synonyms: GD:REM GES
UniProtKB ID: O75628, E1P5L1, Q5TZR7, Q5TZR8, Q9NP57
Gene ID:
Human(28954) Summary: The protein encoded by this gene is a GTPase and member of the RAS-like GTP-binding protein family. The encoded protein is expressed in endothelial cells, where it promotes reorganization of the actin cytoskeleton and morphological changes in the cells. [provided by RefSeq, Jul 2008]
Mouse(19700) rad and gem related GTP binding protein 1
Rat(366232) RAS (RAD and GEM)-like GTP-binding 1
naked mole-rat(101715995) RAS (RAD and GEM)-like GTP-binding 1
domestic guinea pig(100716762) RAS (RAD and GEM)-like GTP-binding 1
cow(508364) RAS (RAD and GEM)-like GTP-binding 1
sheep(100302062) RAS (RAD and GEM)-like GTP-binding 1
Thale Cress(829288) B3 domain-containing protein REM1
Zebrafish(394149) rad and gem related GTP binding protein 1
domestic cat(101081212) RAS (RAD and GEM)-like GTP-binding 1
dog(485823) RAS (RAD and GEM)-like GTP-binding 1
chicken(419274) RAS (RAD and GEM)-like GTP-binding 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087551 MISSION® esiRNA esiRNA targeting mouse Rem1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014012 Rosetta Predictions human pricing
NM_001025753 Rosetta Predictions rat pricing
NM_009047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239392 predicted 1149
2 SASI_Hs01_00239393 predicted 888
3 SASI_Hs01_00239394 predicted 1251
4 SASI_Hs01_00239395 predicted 833
5 SASI_Hs01_00239396 predicted 1155
6 SASI_Hs01_00239397 predicted 512
7 SASI_Hs01_00239398 predicted 934
8 SASI_Hs01_00239399 predicted 1257
9 SASI_Hs01_00239400 predicted 587
10 SASI_Hs02_00344984 predicted 523
11 SASI_Hs01_00239401 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076802 predicted 1088
2 SASI_Rn02_00203421 predicted 538
3 SASI_Rn01_00076804 predicted 584
4 SASI_Rn01_00076805 predicted 435
5 SASI_Rn01_00076806 predicted 477
6 SASI_Rn01_00076807 predicted 389
7 SASI_Rn01_00076808 predicted 467
8 SASI_Rn01_00076809 predicted 842
9 SASI_Rn01_00076811 predicted 1103
10 SASI_Rn02_00203422 predicted 403
11 SASI_Rn01_00076803 predicted 628
12 SASI_Rn01_00076810 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136317 predicted 606
2 SASI_Mm01_00136318 predicted 1078
3 SASI_Mm01_00136319 predicted 1031
4 SASI_Mm01_00136320 predicted 781
5 SASI_Mm02_00315207 predicted 1032
6 SASI_Mm01_00136322 predicted 465
7 SASI_Mm02_00315208 predicted 235
8 SASI_Mm01_00136323 predicted 993
9 SASI_Mm01_00136324 predicted 571
10 SASI_Mm01_00136325 predicted 651
11 SASI_Mm01_00136321 predicted 421
12 SASI_Mm01_00136326 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014012
REM1 MISSION shRNA Bacterial Glycerol Stock
RAS (RAD and GEM)-like GTP-binding 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014012.4-1467s1c1
Sequence:CCGGCCCTCAGAAACCCTCACAATACTCGAGTATTGTGAGGGTTTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-924s1c1
Sequence:CCGGGCTGTGGTGTTCGACTGTAAACTCGAGTTTACAGTCGAACACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-471s1c1
Sequence:CCGGCCAGATGATTGGTCTTCTGAACTCGAGTTCAGAAGACCAATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-472s1c1
Sequence:CCGGCAGATGATTGGTCTTCTGAATCTCGAGATTCAGAAGACCAATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-693s1c1
Sequence:CCGGGAGGCCGAGAAACTGGATAAACTCGAGTTTATCCAGTTTCTCGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014012
REM1 MISSION shRNA shRNA Plasmid DNA
RAS (RAD and GEM)-like GTP-binding 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014012.4-1467s1c1
Sequence:CCGGCCCTCAGAAACCCTCACAATACTCGAGTATTGTGAGGGTTTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-924s1c1
Sequence:CCGGGCTGTGGTGTTCGACTGTAAACTCGAGTTTACAGTCGAACACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-471s1c1
Sequence:CCGGCCAGATGATTGGTCTTCTGAACTCGAGTTCAGAAGACCAATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-472s1c1
Sequence:CCGGCAGATGATTGGTCTTCTGAATCTCGAGATTCAGAAGACCAATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-693s1c1
Sequence:CCGGGAGGCCGAGAAACTGGATAAACTCGAGTTTATCCAGTTTCTCGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014012
REM1 MISSION shRNA Lentiviral Transduction Particles
RAS (RAD and GEM)-like GTP-binding 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014012.4-1467s1c1
Sequence:CCGGCCCTCAGAAACCCTCACAATACTCGAGTATTGTGAGGGTTTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-924s1c1
Sequence:CCGGGCTGTGGTGTTCGACTGTAAACTCGAGTTTACAGTCGAACACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-471s1c1
Sequence:CCGGCCAGATGATTGGTCTTCTGAACTCGAGTTCAGAAGACCAATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-472s1c1
Sequence:CCGGCAGATGATTGGTCTTCTGAATCTCGAGATTCAGAAGACCAATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014012.4-693s1c1
Sequence:CCGGGAGGCCGAGAAACTGGATAAACTCGAGTTTATCCAGTTTCTCGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009047
REM1 MISSION shRNA Bacterial Glycerol Stock
RAS (RAD and GEM)-like GTP-binding 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009047.4-920s1c1
Sequence:CCGGGCACAATGTGACAGAGCTCTTCTCGAGAAGAGCTCTGTCACATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009047.4-646s1c1
Sequence:CCGGCTGAGAAACTGGATGAAAGCTCTCGAGAGCTTTCATCCAGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009047.4-1433s1c1
Sequence:CCGGCTCTCAGAATGTACCACAATACTCGAGTATTGTGGTACATTCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009047.4-1422s1c1
Sequence:CCGGGATATGACCAACTCTCAGAATCTCGAGATTCTGAGAGTTGGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009047
REM1 MISSION shRNA shRNA Plasmid DNA
RAS (RAD and GEM)-like GTP-binding 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009047.4-920s1c1
Sequence:CCGGGCACAATGTGACAGAGCTCTTCTCGAGAAGAGCTCTGTCACATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009047.4-646s1c1
Sequence:CCGGCTGAGAAACTGGATGAAAGCTCTCGAGAGCTTTCATCCAGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009047.4-1433s1c1
Sequence:CCGGCTCTCAGAATGTACCACAATACTCGAGTATTGTGGTACATTCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009047.4-1422s1c1
Sequence:CCGGGATATGACCAACTCTCAGAATCTCGAGATTCTGAGAGTTGGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009047
REM1 MISSION shRNA Lentiviral Transduction Particles
RAS (RAD and GEM)-like GTP-binding 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009047.4-920s1c1
Sequence:CCGGGCACAATGTGACAGAGCTCTTCTCGAGAAGAGCTCTGTCACATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009047.4-646s1c1
Sequence:CCGGCTGAGAAACTGGATGAAAGCTCTCGAGAGCTTTCATCCAGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009047.4-1433s1c1
Sequence:CCGGCTCTCAGAATGTACCACAATACTCGAGTATTGTGGTACATTCTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009047.4-1422s1c1
Sequence:CCGGGATATGACCAACTCTCAGAATCTCGAGATTCTGAGAGTTGGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks