EMAIL THIS PAGE TO A FRIEND

REPIN1

replication initiator 1

Synonyms: AP4 RIP60 ZNF464 Zfp464
UniProtKB ID: Q9BWE0, D3DWZ1, Q7LE03, Q9BUZ6, Q9NZH2, Q9UMP5
Gene ID:
Mouse(58887) replication initiator 1
Rat(445541) replication initiator 1
dog(482792) replication initiator 1
domestic cat(101091683) replication initiator 1
dog(100687780) replication initiator 1
Horse(100051431) replication initiator 1
naked mole-rat(101725348) replication initiator 1
domestic guinea pig(100713194) replication initiator 1
cow(511510) replication initiator 1
sheep(101109172) replication initiator 1
175 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013400 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099695 Rosetta Predictions human pricing
NM_001099696 Rosetta Predictions human pricing
NM_013400 Rosetta Predictions human pricing
NM_014374 Rosetta Predictions human pricing
NM_001005893 Rosetta Predictions rat pricing
NM_001079901 Rosetta Predictions mouse pricing
NM_001079902 Rosetta Predictions mouse pricing
NM_001079903 Rosetta Predictions mouse pricing
NM_001079904 Rosetta Predictions mouse pricing
NM_001079905 Rosetta Predictions mouse pricing
NM_175099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321153 predicted 2049
2 SASI_Hs02_00321154 predicted 1993
3 SASI_Hs02_00321155 predicted 2014
4 SASI_Hs02_00321156 predicted 2042
5 SASI_Hs02_00321157 predicted 2032
6 SASI_Hs02_00321158 predicted 201
7 SASI_Hs02_00321159 predicted 2515
8 SASI_Hs02_00321160 predicted 1094
9 SASI_Hs02_00321161 predicted 1071
10 SASI_Hs02_00321162 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321163 predicted 1852
2 SASI_Hs02_00321164 predicted 1795
3 SASI_Hs02_00321165 predicted 1813
4 SASI_Hs02_00321166 predicted 1842
5 SASI_Hs02_00321167 predicted 1825
6 SASI_Hs02_00321168 predicted 2322
7 SASI_Hs02_00321169 predicted 896
8 SASI_Hs02_00321170 predicted 864
9 SASI_Hs02_00321171 predicted 1078
10 SASI_Hs02_00321172 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344778 predicted 2176
2 SASI_Hs02_00344779 predicted 2124
3 SASI_Hs02_00344780 predicted 2132
4 SASI_Hs02_00344781 predicted 2165
5 SASI_Hs02_00344782 predicted 2158
6 SASI_Hs01_00112025 predicted 2640
7 SASI_Hs01_00112026 predicted 1219
8 SASI_Hs01_00112027 predicted 2597
9 SASI_Hs01_00112030 predicted 1190
10 SASI_Hs01_00112031 predicted 2529
11 SASI_Hs01_00112024 predicted 1359
12 SASI_Hs01_00112028 predicted 558
13 SASI_Hs01_00112029 predicted 2208
14 SASI_Hs01_00112032 predicted 537
15 SASI_Hs01_00112033 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345526 predicted 1758
2 SASI_Hs02_00345527 predicted 1700
3 SASI_Hs02_00345528 predicted 1722
4 SASI_Hs02_00345529 predicted 1756
5 SASI_Hs02_00345530 predicted 1740
6 SASI_Hs01_00088435 predicted 2228
7 SASI_Hs01_00088436 predicted 804
8 SASI_Hs02_00345531 predicted 2177
9 SASI_Hs01_00088437 predicted 774
10 SASI_Hs01_00088438 predicted 2110
11 SASI_Hs01_00088434 predicted 1296
12 SASI_Hs01_00088439 predicted 994
13 SASI_Hs01_00088440 predicted 522
14 SASI_Hs01_00088441 predicted 1605
15 SASI_Hs01_00088442 predicted 2215
16 SASI_Hs01_00088443 predicted 2077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050953 predicted 1179
2 SASI_Rn01_00050954 predicted 560
3 SASI_Rn01_00050955 predicted 1415
4 SASI_Rn01_00050956 predicted 1325
5 SASI_Rn01_00050957 predicted 1261
6 SASI_Rn02_00198482 predicted 1243
7 SASI_Rn01_00050959 predicted 433
8 SASI_Rn01_00050960 predicted 855
9 SASI_Rn01_00050961 predicted 839
10 SASI_Rn01_00050962 predicted 947
11 SASI_Rn01_00050958 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293202 predicted 1868
2 SASI_Mm02_00293203 predicted 2076
3 SASI_Mm02_00293204 predicted 2138
4 SASI_Mm02_00293205 predicted 1859
5 SASI_Mm02_00293206 predicted 647
6 SASI_Mm02_00293207 predicted 1936
7 SASI_Mm02_00293208 predicted 2131
8 SASI_Mm02_00293209 predicted 1336
9 SASI_Mm02_00293210 predicted 2027
10 SASI_Mm02_00293211 predicted 2101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293212 predicted 1873
2 SASI_Mm02_00293213 predicted 2075
3 SASI_Mm02_00293214 predicted 2138
4 SASI_Mm02_00293215 predicted 1858
5 SASI_Mm02_00293216 predicted 644
6 SASI_Mm02_00293217 predicted 1929
7 SASI_Mm02_00293218 predicted 2133
8 SASI_Mm02_00293219 predicted 1335
9 SASI_Mm02_00293220 predicted 2024
10 SASI_Mm02_00293221 predicted 2101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293222 predicted 1802
2 SASI_Mm02_00293223 predicted 2008
3 SASI_Mm02_00293224 predicted 2075
4 SASI_Mm02_00293225 predicted 1792
5 SASI_Mm02_00293226 predicted 570
6 SASI_Mm02_00293227 predicted 1863
7 SASI_Mm02_00293228 predicted 2063
8 SASI_Mm02_00293229 predicted 1260
9 SASI_Mm02_00293230 predicted 1957
10 SASI_Mm02_00293231 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293232 predicted 1795
2 SASI_Mm02_00293233 predicted 2003
3 SASI_Mm02_00293234 predicted 2070
4 SASI_Mm02_00293235 predicted 1786
5 SASI_Mm02_00293236 predicted 568
6 SASI_Mm02_00293237 predicted 1863
7 SASI_Mm02_00293238 predicted 2057
8 SASI_Mm02_00293239 predicted 1261
9 SASI_Mm02_00293240 predicted 1956
10 SASI_Mm02_00293241 predicted 2031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293242 predicted 1688
2 SASI_Mm02_00293243 predicted 1892
3 SASI_Mm02_00293244 predicted 1951
4 SASI_Mm02_00293245 predicted 1668
5 SASI_Mm02_00293246 predicted 459
6 SASI_Mm02_00293247 predicted 1745
7 SASI_Mm02_00293248 predicted 1940
8 SASI_Mm02_00293249 predicted 1144
9 SASI_Mm02_00293250 predicted 1841
10 SASI_Mm02_00293251 predicted 1914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149673 predicted 1687
2 SASI_Mm01_00149674 predicted 1891
3 SASI_Mm01_00149676 predicted 1953
4 SASI_Mm01_00149677 predicted 1676
5 SASI_Mm01_00149680 predicted 461
6 SASI_Mm01_00149681 predicted 1748
7 SASI_Mm01_00149682 predicted 1942
8 SASI_Mm02_00345693 predicted 1145
9 SASI_Mm02_00345694 predicted 1848
10 SASI_Mm02_00345695 predicted 1918
11 SASI_Mm01_00149675 predicted 1293
12 SASI_Mm01_00149678 predicted 845
13 SASI_Mm01_00149679 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013400
VALIDATED
REPIN1 MISSION shRNA Bacterial Glycerol Stock
replication initiator 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-943s1c1
Sequence:CCGGCGCTTTACCAATAAGCCCTATCTCGAGATAGGGCTTATTGGTAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-1058s1c1
Sequence:CCGGACAGCAAGATTCACAAGCGATCTCGAGATCGCTTGTGAATCTTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-582s1c1
Sequence:CCGGGAGACGCTTCTGGCGACGAAACTCGAGTTTCGTCGCCAGAAGCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-1701s1c1
Sequence:CCGGCAGCCAGAAGTCCAACCTCATCTCGAGATGAGGTTGGACTTCTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-534s1c1
Sequence:CCGGGCTGGCCCATTCAGCTGCAAACTCGAGTTTGCAGCTGAATGGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013400.3-1715s21c1
Sequence:CCGGGGAAGAACTTCGGCAAGAAGACTCGAGTCTTCTTGCCGAAGTTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_013400.3-1295s21c1
Sequence:CCGGGCGGGAAGCGCTTTACCAATACTCGAGTATTGGTAAAGCGCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_013400.3-2170s21c1
Sequence:CCGGCACCAGAAGAAGCACGATGTCCTCGAGGACATCGTGCTTCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_013400.3-926s21c1
Sequence:CCGGCTTGTCCCAAATGCGAGAGACCTCGAGGTCTCTCGCATTTGGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013400.3-2525s21c1
Sequence:CCGGCCTCCATCCTCTGGTATTAACCTCGAGGTTAATACCAGAGGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013400.3-1230s21c1
Sequence:CCGGCAAGCCCAACTTGATCGCTCACTCGAGTGAGCGATCAAGTTGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013400
VALIDATED
REPIN1 MISSION shRNA shRNA Plasmid DNA
replication initiator 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-943s1c1
Sequence:CCGGCGCTTTACCAATAAGCCCTATCTCGAGATAGGGCTTATTGGTAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-1058s1c1
Sequence:CCGGACAGCAAGATTCACAAGCGATCTCGAGATCGCTTGTGAATCTTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-582s1c1
Sequence:CCGGGAGACGCTTCTGGCGACGAAACTCGAGTTTCGTCGCCAGAAGCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-1701s1c1
Sequence:CCGGCAGCCAGAAGTCCAACCTCATCTCGAGATGAGGTTGGACTTCTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-534s1c1
Sequence:CCGGGCTGGCCCATTCAGCTGCAAACTCGAGTTTGCAGCTGAATGGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013400.3-1715s21c1
Sequence:CCGGGGAAGAACTTCGGCAAGAAGACTCGAGTCTTCTTGCCGAAGTTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_013400.3-1295s21c1
Sequence:CCGGGCGGGAAGCGCTTTACCAATACTCGAGTATTGGTAAAGCGCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_013400.3-2170s21c1
Sequence:CCGGCACCAGAAGAAGCACGATGTCCTCGAGGACATCGTGCTTCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_013400.3-926s21c1
Sequence:CCGGCTTGTCCCAAATGCGAGAGACCTCGAGGTCTCTCGCATTTGGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013400.3-2525s21c1
Sequence:CCGGCCTCCATCCTCTGGTATTAACCTCGAGGTTAATACCAGAGGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013400.3-1230s21c1
Sequence:CCGGCAAGCCCAACTTGATCGCTCACTCGAGTGAGCGATCAAGTTGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013400
VALIDATED
REPIN1 MISSION shRNA Lentiviral Transduction Particles
replication initiator 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-943s1c1
Sequence:CCGGCGCTTTACCAATAAGCCCTATCTCGAGATAGGGCTTATTGGTAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-1058s1c1
Sequence:CCGGACAGCAAGATTCACAAGCGATCTCGAGATCGCTTGTGAATCTTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-582s1c1
Sequence:CCGGGAGACGCTTCTGGCGACGAAACTCGAGTTTCGTCGCCAGAAGCGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-1701s1c1
Sequence:CCGGCAGCCAGAAGTCCAACCTCATCTCGAGATGAGGTTGGACTTCTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013400.1-534s1c1
Sequence:CCGGGCTGGCCCATTCAGCTGCAAACTCGAGTTTGCAGCTGAATGGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013400.3-1715s21c1
Sequence:CCGGGGAAGAACTTCGGCAAGAAGACTCGAGTCTTCTTGCCGAAGTTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_013400.3-1295s21c1
Sequence:CCGGGCGGGAAGCGCTTTACCAATACTCGAGTATTGGTAAAGCGCTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_013400.3-2170s21c1
Sequence:CCGGCACCAGAAGAAGCACGATGTCCTCGAGGACATCGTGCTTCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_013400.3-926s21c1
Sequence:CCGGCTTGTCCCAAATGCGAGAGACCTCGAGGTCTCTCGCATTTGGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013400.3-2525s21c1
Sequence:CCGGCCTCCATCCTCTGGTATTAACCTCGAGGTTAATACCAGAGGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013400.3-1230s21c1
Sequence:CCGGCAAGCCCAACTTGATCGCTCACTCGAGTGAGCGATCAAGTTGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175099
VALIDATED
REPIN1 MISSION shRNA Bacterial Glycerol Stock
replication initiator 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175099.2-1277s1c1
Sequence:CCGGCACAGAGTGTGGCAAGAACTTCTCGAGAAGTTCTTGCCACACTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175099.2-2746s1c1
Sequence:CCGGGCGAGTCTAATTGTTAGACATCTCGAGATGTCTAACAATTAGACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175099.2-2099s1c1
Sequence:CCGGCCGTTCTATCCTCTGGTGTTACTCGAGTAACACCAGAGGATAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175099.2-1897s1c1
Sequence:CCGGGCTCTGTTTAGGAATGGACTTCTCGAGAAGTCCATTCCTAAACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175099
VALIDATED
REPIN1 MISSION shRNA shRNA Plasmid DNA
replication initiator 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175099.2-1277s1c1
Sequence:CCGGCACAGAGTGTGGCAAGAACTTCTCGAGAAGTTCTTGCCACACTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175099.2-2746s1c1
Sequence:CCGGGCGAGTCTAATTGTTAGACATCTCGAGATGTCTAACAATTAGACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175099.2-2099s1c1
Sequence:CCGGCCGTTCTATCCTCTGGTGTTACTCGAGTAACACCAGAGGATAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175099.2-1897s1c1
Sequence:CCGGGCTCTGTTTAGGAATGGACTTCTCGAGAAGTCCATTCCTAAACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175099
VALIDATED
REPIN1 MISSION shRNA Lentiviral Transduction Particles
replication initiator 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175099.2-1277s1c1
Sequence:CCGGCACAGAGTGTGGCAAGAACTTCTCGAGAAGTTCTTGCCACACTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175099.2-2746s1c1
Sequence:CCGGGCGAGTCTAATTGTTAGACATCTCGAGATGTCTAACAATTAGACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175099.2-2099s1c1
Sequence:CCGGCCGTTCTATCCTCTGGTGTTACTCGAGTAACACCAGAGGATAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175099.2-1897s1c1
Sequence:CCGGGCTCTGTTTAGGAATGGACTTCTCGAGAAGTCCATTCCTAAACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks