EMAIL THIS PAGE TO A FRIEND

REV1

REV1, polymerase (DNA directed)

Synonyms: REV1L
UniProtKB ID: Q9UBZ9, O95941, Q53SI7, Q9C0J4, Q9NUP2
Gene ID:
Human(51455) Summary: This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA. Two alternatively spliced transcript variants that encode different proteins have been found. [provided by RefSeq, Jul 2008]
Mouse(56210) REV1 homolog (S. cerevisiae)
Rat(316344) REV1, polymerase (DNA directed)
fruit fly(38079) CG12189 gene product from transcript CG12189-RA
Horse(100050347) REV1, polymerase (DNA directed)
dog(481337) REV1, polymerase (DNA directed)
Thale Cress(834504) DNA repair protein REV1
Zebrafish(570043) REV1, polymerase (DNA directed)
chicken(418703) REV1, polymerase (DNA directed)
Domestic Rabbit(100345920) REV1, polymerase (DNA directed)
naked mole-rat(101699664) REV1, polymerase (DNA directed)
domestic guinea pig(100725580) REV1, polymerase (DNA directed)
cow(513657) REV1 homolog (S. cerevisiae)
cow(616986) REV1, polymerase (DNA directed)
sheep(101105811) REV1, polymerase (DNA directed)
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037872 Rosetta Predictions human pricing
NM_016316 Rosetta Predictions human pricing
NM_001108213 Rosetta Predictions rat pricing
NM_019570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182232 predicted 2974
2 SASI_Hs01_00182233 predicted 1088
3 SASI_Hs02_00308381 predicted 2452
4 SASI_Hs02_00308382 predicted 896
5 SASI_Hs02_00308383 predicted 588
6 SASI_Hs01_00182235 predicted 1058
7 SASI_Hs01_00182236 predicted 4027
8 SASI_Hs01_00182237 predicted 2750
9 SASI_Hs01_00182240 predicted 1864
10 SASI_Hs01_00182241 predicted 2442
11 SASI_Hs01_00182234 predicted 1982
12 SASI_Hs01_00182238 predicted 3792
13 SASI_Hs01_00182239 predicted 2674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170313 predicted 2985
2 SASI_Hs01_00170314 predicted 1084
3 SASI_Hs02_00349252 predicted 2458
4 SASI_Hs02_00349253 predicted 894
5 SASI_Hs02_00349254 predicted 588
6 SASI_Hs01_00170316 predicted 1066
7 SASI_Hs01_00170317 predicted 4033
8 SASI_Hs01_00170318 predicted 2753
9 SASI_Hs01_00170321 predicted 1871
10 SASI_Hs01_00170322 predicted 2444
11 SASI_Hs01_00170315 predicted 1986
12 SASI_Hs01_00170319 predicted 3788
13 SASI_Hs01_00170320 predicted 2675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236434 predicted 1447
2 SASI_Rn02_00236435 predicted 2458
3 SASI_Rn02_00236436 predicted 2094
4 SASI_Rn02_00236437 predicted 248
5 SASI_Rn02_00236438 predicted 1596
6 SASI_Rn02_00236439 predicted 2760
7 SASI_Rn02_00236440 predicted 2398
8 SASI_Rn02_00236441 predicted 1068
9 SASI_Rn02_00236442 predicted 328
10 SASI_Rn02_00236443 predicted 2243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097490 predicted 1650
2 SASI_Mm01_00097491 predicted 439
3 SASI_Mm01_00097493 predicted 1482
4 SASI_Mm01_00097494 predicted 1913
5 SASI_Mm02_00324624 predicted 994
6 SASI_Mm01_00097495 predicted 2914
7 SASI_Mm02_00324625 predicted 772
8 SASI_Mm01_00097496 predicted 1654
9 SASI_Mm01_00097497 predicted 2839
10 SASI_Mm01_00097498 predicted 1936
11 SASI_Mm01_00097492 predicted 373
12 SASI_Mm01_00097499 predicted 1750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016316
REV1 MISSION shRNA Bacterial Glycerol Stock
REV1, polymerase (DNA directed)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-425s21c1
Sequence:CCGGGATGTTGCATGGAGGTCAATACTCGAGTATTGACCTCCATGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-2359s21c1
Sequence:CCGGTCAACTATGGAATAAGGTTTACTCGAGTAAACCTTATTCCATAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-700s21c1
Sequence:CCGGAGCTCAACAACAGGGTAAATCCTCGAGGATTTACCCTGTTGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-1498s21c1
Sequence:CCGGTATCAGTGGGTATACGAAATACTCGAGTATTTCGTATACCCACTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-1921s21c1
Sequence:CCGGATGAAGCGCTGGTAGACATTACTCGAGTAATGTCTACCAGCGCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016316.1-540s1c1
Sequence:CCGGCGACCAGAATGGATTGTGGAACTCGAGTTCCACAATCCATTCTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-1693s1c1
Sequence:CCGGCGCAAGCAAATGGAATTGATTCTCGAGAATCAATTCCATTTGCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-3491s1c1
Sequence:CCGGGCTGCTTAACAGTCCTGCAAACTCGAGTTTGCAGGACTGTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-3871s1c1
Sequence:CCGGCGGTGGAATCGGTTTGGAATACTCGAGTATTCCAAACCGATTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016316.1-4007s1c1
Sequence:CCGGCATAAGTGCTTGTGAGGTATTCTCGAGAATACCTCACAAGCACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-1989s1c1
Sequence:CCGGGCTGTTCGTATGGAAATCAAACTCGAGTTTGATTTCCATACGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016316.1-3539s1c1
Sequence:CCGGCCAGAAGTTAATTGATGGGTTCTCGAGAACCCATCAATTAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016316
REV1 MISSION shRNA shRNA Plasmid DNA
REV1, polymerase (DNA directed)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-425s21c1
Sequence:CCGGGATGTTGCATGGAGGTCAATACTCGAGTATTGACCTCCATGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-2359s21c1
Sequence:CCGGTCAACTATGGAATAAGGTTTACTCGAGTAAACCTTATTCCATAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-700s21c1
Sequence:CCGGAGCTCAACAACAGGGTAAATCCTCGAGGATTTACCCTGTTGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-1498s21c1
Sequence:CCGGTATCAGTGGGTATACGAAATACTCGAGTATTTCGTATACCCACTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-1921s21c1
Sequence:CCGGATGAAGCGCTGGTAGACATTACTCGAGTAATGTCTACCAGCGCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016316.1-540s1c1
Sequence:CCGGCGACCAGAATGGATTGTGGAACTCGAGTTCCACAATCCATTCTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-1693s1c1
Sequence:CCGGCGCAAGCAAATGGAATTGATTCTCGAGAATCAATTCCATTTGCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-3491s1c1
Sequence:CCGGGCTGCTTAACAGTCCTGCAAACTCGAGTTTGCAGGACTGTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-3871s1c1
Sequence:CCGGCGGTGGAATCGGTTTGGAATACTCGAGTATTCCAAACCGATTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016316.1-4007s1c1
Sequence:CCGGCATAAGTGCTTGTGAGGTATTCTCGAGAATACCTCACAAGCACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-1989s1c1
Sequence:CCGGGCTGTTCGTATGGAAATCAAACTCGAGTTTGATTTCCATACGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016316.1-3539s1c1
Sequence:CCGGCCAGAAGTTAATTGATGGGTTCTCGAGAACCCATCAATTAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016316
REV1 MISSION shRNA Lentiviral Transduction Particles
REV1, polymerase (DNA directed)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-425s21c1
Sequence:CCGGGATGTTGCATGGAGGTCAATACTCGAGTATTGACCTCCATGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-2359s21c1
Sequence:CCGGTCAACTATGGAATAAGGTTTACTCGAGTAAACCTTATTCCATAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-700s21c1
Sequence:CCGGAGCTCAACAACAGGGTAAATCCTCGAGGATTTACCCTGTTGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-1498s21c1
Sequence:CCGGTATCAGTGGGTATACGAAATACTCGAGTATTTCGTATACCCACTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016316.2-1921s21c1
Sequence:CCGGATGAAGCGCTGGTAGACATTACTCGAGTAATGTCTACCAGCGCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016316.1-540s1c1
Sequence:CCGGCGACCAGAATGGATTGTGGAACTCGAGTTCCACAATCCATTCTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-1693s1c1
Sequence:CCGGCGCAAGCAAATGGAATTGATTCTCGAGAATCAATTCCATTTGCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-3491s1c1
Sequence:CCGGGCTGCTTAACAGTCCTGCAAACTCGAGTTTGCAGGACTGTTAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-3871s1c1
Sequence:CCGGCGGTGGAATCGGTTTGGAATACTCGAGTATTCCAAACCGATTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016316.1-4007s1c1
Sequence:CCGGCATAAGTGCTTGTGAGGTATTCTCGAGAATACCTCACAAGCACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016316.1-1989s1c1
Sequence:CCGGGCTGTTCGTATGGAAATCAAACTCGAGTTTGATTTCCATACGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016316.1-3539s1c1
Sequence:CCGGCCAGAAGTTAATTGATGGGTTCTCGAGAACCCATCAATTAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019570
VALIDATED
REV1 MISSION shRNA Bacterial Glycerol Stock
REV1, polymerase (DNA directed)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000366597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019570.3-1491s21c1
Sequence:CCGGTATCAGTGGGTATACGAAATACTCGAGTATTTCGTATACCCACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019570.3-699s21c1
Sequence:CCGGAGCTCAACAACAGGGTAAATCCTCGAGGATTTACCCTGTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019570.3-424s21c1
Sequence:CCGGGATGTTGCATGGAGGTCAATACTCGAGTATTGACCTCCATGCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019570.3-1813s21c1
Sequence:CCGGGCAAGCTGTTCCGTATGATTTCTCGAGAAATCATACGGAACAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019570.3-956s21c1
Sequence:CCGGGTTGCTAGCAGGCTATCTTTACTCGAGTAAAGATAGCCTGCTAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019570.3-2345s1c1
Sequence:CCGGGCCGAGATCAACTATGGAATACTCGAGTATTCCATAGTTGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019570.3-1465s1c1
Sequence:CCGGGCACGTTGATATGGACTGCTTCTCGAGAAGCAGTCCATATCAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019570.3-774s1c1
Sequence:CCGGGCTGGAATGAAGACGGTGTAACTCGAGTTACACCGTCTTCATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019570.3-1982s1c1
Sequence:CCGGGCCCTCCGTATTGAAATCAAACTCGAGTTTGATTTCAATACGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019570
VALIDATED
REV1 MISSION shRNA shRNA Plasmid DNA
REV1, polymerase (DNA directed)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000366597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019570.3-1491s21c1
Sequence:CCGGTATCAGTGGGTATACGAAATACTCGAGTATTTCGTATACCCACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019570.3-699s21c1
Sequence:CCGGAGCTCAACAACAGGGTAAATCCTCGAGGATTTACCCTGTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019570.3-424s21c1
Sequence:CCGGGATGTTGCATGGAGGTCAATACTCGAGTATTGACCTCCATGCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019570.3-1813s21c1
Sequence:CCGGGCAAGCTGTTCCGTATGATTTCTCGAGAAATCATACGGAACAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019570.3-956s21c1
Sequence:CCGGGTTGCTAGCAGGCTATCTTTACTCGAGTAAAGATAGCCTGCTAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019570.3-2345s1c1
Sequence:CCGGGCCGAGATCAACTATGGAATACTCGAGTATTCCATAGTTGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019570.3-1465s1c1
Sequence:CCGGGCACGTTGATATGGACTGCTTCTCGAGAAGCAGTCCATATCAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019570.3-774s1c1
Sequence:CCGGGCTGGAATGAAGACGGTGTAACTCGAGTTACACCGTCTTCATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019570.3-1982s1c1
Sequence:CCGGGCCCTCCGTATTGAAATCAAACTCGAGTTTGATTTCAATACGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019570
VALIDATED
REV1 MISSION shRNA Lentiviral Transduction Particles
REV1, polymerase (DNA directed)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000366597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019570.3-1491s21c1
Sequence:CCGGTATCAGTGGGTATACGAAATACTCGAGTATTTCGTATACCCACTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019570.3-699s21c1
Sequence:CCGGAGCTCAACAACAGGGTAAATCCTCGAGGATTTACCCTGTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019570.3-424s21c1
Sequence:CCGGGATGTTGCATGGAGGTCAATACTCGAGTATTGACCTCCATGCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019570.3-1813s21c1
Sequence:CCGGGCAAGCTGTTCCGTATGATTTCTCGAGAAATCATACGGAACAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019570.3-956s21c1
Sequence:CCGGGTTGCTAGCAGGCTATCTTTACTCGAGTAAAGATAGCCTGCTAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019570.3-2345s1c1
Sequence:CCGGGCCGAGATCAACTATGGAATACTCGAGTATTCCATAGTTGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019570.3-1465s1c1
Sequence:CCGGGCACGTTGATATGGACTGCTTCTCGAGAAGCAGTCCATATCAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019570.3-774s1c1
Sequence:CCGGGCTGGAATGAAGACGGTGTAACTCGAGTTACACCGTCTTCATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019570.3-1982s1c1
Sequence:CCGGGCCCTCCGTATTGAAATCAAACTCGAGTTTGATTTCAATACGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks