EMAIL THIS PAGE TO A FRIEND

RFC2

replication factor C (activator 1) 2, 40kDa

Synonyms: RFC40
UniProtKB ID: P35250, B5BU07, D3DXG3, P32846, Q9BU93
Gene ID:
Human(5982) Summary: This gene encodes a member of the activator 1 small subunits family. The elongation of primed DNA templates by DNA polymerase delta and epsilon requires the action of the accessory proteins, proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). Replication factor C, also called activator 1, is a protein complex consisting of five distinct subunits. This gene encodes the 40 kD subunit, which has been shown to be responsible for binding ATP and may help promote cell survival. Disruption of this gene is associated with Williams syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene of this gene has been defined on chromosome 2. [provided by RefSeq, Jul 2013]
Mouse(19718) replication factor C (activator 1) 2
Rat(116468) replication factor C (activator 1) 2
cow(508652) replication factor C (activator 1) 2, 40kDa
sheep(101110382) replication factor C (activator 1) 2, 40kDa
naked mole-rat(101697046) replication factor C (activator 1) 2, 40kDa
domestic guinea pig(100713099) replication factor C (activator 1) 2, 40kDa
Thale Cress(842620) replication factor C 2
domestic cat(101094392) replication factor C (activator 1) 2, 40kDa
dog(489798) replication factor C (activator 1) 2, 40kDa
chicken(396542) replication factor C (activator 1) 2, 40kDa
Zebrafish(503748) replication factor C (activator 1) 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181471 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002914 Rosetta Predictions human pricing
NM_181471 Rosetta Predictions human pricing
NM_053786 Rosetta Predictions rat pricing
NM_020022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232347 predicted 637
2 SASI_Hs01_00232348 predicted 659
3 SASI_Hs01_00232349 predicted 857
4 SASI_Hs01_00232350 predicted 571
5 SASI_Hs01_00232351 predicted 731
6 SASI_Hs01_00232352 predicted 726
7 SASI_Hs01_00232353 predicted 780
8 SASI_Hs01_00232354 predicted 795
9 SASI_Hs01_00232355 predicted 862
10 SASI_Hs01_00232356 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194513 predicted 744
2 SASI_Hs01_00194514 predicted 761
3 SASI_Hs01_00194515 predicted 957
4 SASI_Hs01_00194516 predicted 673
5 SASI_Hs01_00194517 predicted 834
6 SASI_Hs01_00194518 predicted 832
7 SASI_Hs01_00194519 predicted 886
8 SASI_Hs01_00194520 predicted 899
9 SASI_Hs01_00194521 predicted 961
10 SASI_Hs01_00194522 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063919 predicted 1176
2 SASI_Rn01_00063920 predicted 1006
3 SASI_Rn01_00063921 predicted 737
4 SASI_Rn01_00063922 predicted 757
5 SASI_Rn01_00063923 predicted 414
6 SASI_Rn01_00063924 predicted 851
7 SASI_Rn01_00063925 predicted 837
8 SASI_Rn01_00063926 predicted 354
9 SASI_Rn01_00063927 predicted 616
10 SASI_Rn01_00063928 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036530 predicted 202
2 SASI_Mm01_00036531 predicted 914
3 SASI_Mm01_00036532 predicted 900
4 SASI_Mm02_00325390 predicted 205
5 SASI_Mm02_00325391 predicted 801
6 SASI_Mm01_00036535 predicted 414
7 SASI_Mm01_00036536 predicted 806
8 SASI_Mm01_00036537 predicted 955
9 SASI_Mm02_00325392 predicted 806
10 SASI_Mm01_00036538 predicted 226
11 SASI_Mm01_00036533 predicted 690
12 SASI_Mm01_00036534 predicted 1205
13 SASI_Mm01_00036539 predicted 824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020022
VALIDATED
RFC2 MISSION shRNA Bacterial Glycerol Stock
replication factor C (activator 1) 2, 40kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-1207s1c1
Sequence:CCGGCAGCTAGAACATGCTCACTTTCTCGAGAAAGTGAGCATGTTCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-592s1c1
Sequence:CCGGGCGTGTAATGCTTCAGACAAACTCGAGTTTGTCTGAAGCATTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-1003s1c1
Sequence:CCGGCCGATGGCTGAATACTTGAAACTCGAGTTTCAAGTATTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-390s1c1
Sequence:CCGGCCTGGAACTCAATGCCTCAAACTCGAGTTTGAGGCATTGAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-800s1c1
Sequence:CCGGCCTTCTCAGGATTTGGCTATACTCGAGTATAGCCAAATCCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020022.2-1207s21c1
Sequence:CCGGCAGCTAGAACATGCTCACTTTCTCGAGAAAGTGAGCATGTTCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-1003s21c1
Sequence:CCGGCCGATGGCTGAATACTTGAAACTCGAGTTTCAAGTATTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-800s21c1
Sequence:CCGGCCTTCTCAGGATTTGGCTATACTCGAGTATAGCCAAATCCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-592s21c1
Sequence:CCGGGCGTGTAATGCTTCAGACAAACTCGAGTTTGTCTGAAGCATTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-390s21c1
Sequence:CCGGCCTGGAACTCAATGCCTCAAACTCGAGTTTGAGGCATTGAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020022
VALIDATED
RFC2 MISSION shRNA shRNA Plasmid DNA
replication factor C (activator 1) 2, 40kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-1207s1c1
Sequence:CCGGCAGCTAGAACATGCTCACTTTCTCGAGAAAGTGAGCATGTTCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-592s1c1
Sequence:CCGGGCGTGTAATGCTTCAGACAAACTCGAGTTTGTCTGAAGCATTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-1003s1c1
Sequence:CCGGCCGATGGCTGAATACTTGAAACTCGAGTTTCAAGTATTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-390s1c1
Sequence:CCGGCCTGGAACTCAATGCCTCAAACTCGAGTTTGAGGCATTGAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-800s1c1
Sequence:CCGGCCTTCTCAGGATTTGGCTATACTCGAGTATAGCCAAATCCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020022.2-1207s21c1
Sequence:CCGGCAGCTAGAACATGCTCACTTTCTCGAGAAAGTGAGCATGTTCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-1003s21c1
Sequence:CCGGCCGATGGCTGAATACTTGAAACTCGAGTTTCAAGTATTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-800s21c1
Sequence:CCGGCCTTCTCAGGATTTGGCTATACTCGAGTATAGCCAAATCCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-592s21c1
Sequence:CCGGGCGTGTAATGCTTCAGACAAACTCGAGTTTGTCTGAAGCATTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-390s21c1
Sequence:CCGGCCTGGAACTCAATGCCTCAAACTCGAGTTTGAGGCATTGAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020022
VALIDATED
RFC2 MISSION shRNA Lentiviral Transduction Particles
replication factor C (activator 1) 2, 40kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-1207s1c1
Sequence:CCGGCAGCTAGAACATGCTCACTTTCTCGAGAAAGTGAGCATGTTCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-592s1c1
Sequence:CCGGGCGTGTAATGCTTCAGACAAACTCGAGTTTGTCTGAAGCATTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-1003s1c1
Sequence:CCGGCCGATGGCTGAATACTTGAAACTCGAGTTTCAAGTATTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-390s1c1
Sequence:CCGGCCTGGAACTCAATGCCTCAAACTCGAGTTTGAGGCATTGAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020022.2-800s1c1
Sequence:CCGGCCTTCTCAGGATTTGGCTATACTCGAGTATAGCCAAATCCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020022.2-1207s21c1
Sequence:CCGGCAGCTAGAACATGCTCACTTTCTCGAGAAAGTGAGCATGTTCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-1003s21c1
Sequence:CCGGCCGATGGCTGAATACTTGAAACTCGAGTTTCAAGTATTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-800s21c1
Sequence:CCGGCCTTCTCAGGATTTGGCTATACTCGAGTATAGCCAAATCCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-592s21c1
Sequence:CCGGGCGTGTAATGCTTCAGACAAACTCGAGTTTGTCTGAAGCATTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020022.2-390s21c1
Sequence:CCGGCCTGGAACTCAATGCCTCAAACTCGAGTTTGAGGCATTGAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181471
VALIDATED
RFC2 MISSION shRNA Bacterial Glycerol Stock
replication factor C (activator 1) 2, 40kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181471.1-1184s1c1
Sequence:CCGGGCCAACATGACTGTCCTTTAACTCGAGTTAAAGGACAGTCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_181471.1-163s1c1
Sequence:CCGGGCTGAATGAAATTGTCGGGAACTCGAGTTCCCGACAATTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_181471.1-532s1c1
Sequence:CCGGTGCTTGTAATGCTTCGGATAACTCGAGTTATCCGAAGCATTACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181471.1-360s1c1
Sequence:CCGGGCATTGACGTTGTGAGGAATACTCGAGTATTCCTCACAACGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_181471.1-915s1c1
Sequence:CCGGGCAACATCTTTCGAGTGTGTACTCGAGTACACACTCGAAAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-360s21c1
Sequence:CCGGGCATTGACGTTGTGAGGAATACTCGAGTATTCCTCACAACGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-915s21c1
Sequence:CCGGGCAACATCTTTCGAGTGTGTACTCGAGTACACACTCGAAAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-163s21c1
Sequence:CCGGGCTGAATGAAATTGTCGGGAACTCGAGTTCCCGACAATTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181471.1-1184s21c1
Sequence:CCGGGCCAACATGACTGTCCTTTAACTCGAGTTAAAGGACAGTCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-532s21c1
Sequence:CCGGTGCTTGTAATGCTTCGGATAACTCGAGTTATCCGAAGCATTACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181471
VALIDATED
RFC2 MISSION shRNA shRNA Plasmid DNA
replication factor C (activator 1) 2, 40kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181471.1-1184s1c1
Sequence:CCGGGCCAACATGACTGTCCTTTAACTCGAGTTAAAGGACAGTCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_181471.1-163s1c1
Sequence:CCGGGCTGAATGAAATTGTCGGGAACTCGAGTTCCCGACAATTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_181471.1-532s1c1
Sequence:CCGGTGCTTGTAATGCTTCGGATAACTCGAGTTATCCGAAGCATTACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181471.1-360s1c1
Sequence:CCGGGCATTGACGTTGTGAGGAATACTCGAGTATTCCTCACAACGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_181471.1-915s1c1
Sequence:CCGGGCAACATCTTTCGAGTGTGTACTCGAGTACACACTCGAAAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-360s21c1
Sequence:CCGGGCATTGACGTTGTGAGGAATACTCGAGTATTCCTCACAACGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-915s21c1
Sequence:CCGGGCAACATCTTTCGAGTGTGTACTCGAGTACACACTCGAAAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-163s21c1
Sequence:CCGGGCTGAATGAAATTGTCGGGAACTCGAGTTCCCGACAATTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181471.1-1184s21c1
Sequence:CCGGGCCAACATGACTGTCCTTTAACTCGAGTTAAAGGACAGTCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-532s21c1
Sequence:CCGGTGCTTGTAATGCTTCGGATAACTCGAGTTATCCGAAGCATTACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181471
VALIDATED
RFC2 MISSION shRNA Lentiviral Transduction Particles
replication factor C (activator 1) 2, 40kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181471.1-1184s1c1
Sequence:CCGGGCCAACATGACTGTCCTTTAACTCGAGTTAAAGGACAGTCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_181471.1-163s1c1
Sequence:CCGGGCTGAATGAAATTGTCGGGAACTCGAGTTCCCGACAATTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_181471.1-532s1c1
Sequence:CCGGTGCTTGTAATGCTTCGGATAACTCGAGTTATCCGAAGCATTACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181471.1-360s1c1
Sequence:CCGGGCATTGACGTTGTGAGGAATACTCGAGTATTCCTCACAACGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_181471.1-915s1c1
Sequence:CCGGGCAACATCTTTCGAGTGTGTACTCGAGTACACACTCGAAAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-360s21c1
Sequence:CCGGGCATTGACGTTGTGAGGAATACTCGAGTATTCCTCACAACGTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-915s21c1
Sequence:CCGGGCAACATCTTTCGAGTGTGTACTCGAGTACACACTCGAAAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-163s21c1
Sequence:CCGGGCTGAATGAAATTGTCGGGAACTCGAGTTCCCGACAATTTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181471.1-1184s21c1
Sequence:CCGGGCCAACATGACTGTCCTTTAACTCGAGTTAAAGGACAGTCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181471.1-532s21c1
Sequence:CCGGTGCTTGTAATGCTTCGGATAACTCGAGTTATCCGAAGCATTACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks