EMAIL THIS PAGE TO A FRIEND

RFPL1

ret finger protein-like 1

Synonyms: RNF78
Species: Human RFPL1(5988)
UniProtKB ID: O75677, Q6IC06, Q9UJ97
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021026 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105661 MISSION® esiRNA esiRNA human RFPL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021026 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135058 predicted 373
2 SASI_Hs01_00135059 predicted 1095
3 SASI_Hs01_00135060 predicted 1102
4 SASI_Hs01_00135061 predicted 1065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021026
RFPL1 MISSION shRNA Bacterial Glycerol Stock
ret finger protein-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-609s1c1
Sequence:CCGGGCCAACAACTTCCTCCTCATTCTCGAGAATGAGGAGGAAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-1071s1c1
Sequence:CCGGCCACCTAATGGTGATAAGAGTCTCGAGACTCTTATCACCATTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-1082s1c1
Sequence:CCGGTGATAAGAGTGTCTTGAGTATCTCGAGATACTCAAGACACTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-689s1c1
Sequence:CCGGCGAGAGATTTGACGTGTCCATCTCGAGATGGACACGTCAAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-384s1c1
Sequence:CCGGGTCTGCTTCAAGTGCATCAATCTCGAGATTGATGCACTTGAAGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021026.2-1222s21c1
Sequence:CCGGAGGAACGCTCTACTCGGTAAACTCGAGTTTACCGAGTAGAGCGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021026.2-1311s21c1
Sequence:CCGGGTTTATAAATTGAGTCCTAAGCTCGAGCTTAGGACTCAATTTATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021026
RFPL1 MISSION shRNA shRNA Plasmid DNA
ret finger protein-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-609s1c1
Sequence:CCGGGCCAACAACTTCCTCCTCATTCTCGAGAATGAGGAGGAAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-1071s1c1
Sequence:CCGGCCACCTAATGGTGATAAGAGTCTCGAGACTCTTATCACCATTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-1082s1c1
Sequence:CCGGTGATAAGAGTGTCTTGAGTATCTCGAGATACTCAAGACACTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-689s1c1
Sequence:CCGGCGAGAGATTTGACGTGTCCATCTCGAGATGGACACGTCAAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-384s1c1
Sequence:CCGGGTCTGCTTCAAGTGCATCAATCTCGAGATTGATGCACTTGAAGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021026.2-1222s21c1
Sequence:CCGGAGGAACGCTCTACTCGGTAAACTCGAGTTTACCGAGTAGAGCGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021026.2-1311s21c1
Sequence:CCGGGTTTATAAATTGAGTCCTAAGCTCGAGCTTAGGACTCAATTTATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021026
RFPL1 MISSION shRNA Lentiviral Transduction Particles
ret finger protein-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-609s1c1
Sequence:CCGGGCCAACAACTTCCTCCTCATTCTCGAGAATGAGGAGGAAGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-1071s1c1
Sequence:CCGGCCACCTAATGGTGATAAGAGTCTCGAGACTCTTATCACCATTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-1082s1c1
Sequence:CCGGTGATAAGAGTGTCTTGAGTATCTCGAGATACTCAAGACACTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-689s1c1
Sequence:CCGGCGAGAGATTTGACGTGTCCATCTCGAGATGGACACGTCAAATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021026.1-384s1c1
Sequence:CCGGGTCTGCTTCAAGTGCATCAATCTCGAGATTGATGCACTTGAAGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021026.2-1222s21c1
Sequence:CCGGAGGAACGCTCTACTCGGTAAACTCGAGTTTACCGAGTAGAGCGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021026.2-1311s21c1
Sequence:CCGGGTTTATAAATTGAGTCCTAAGCTCGAGCTTAGGACTCAATTTATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks