EMAIL THIS PAGE TO A FRIEND

RGR

retinal G protein coupled receptor

Synonyms: RP44
UniProtKB ID: P47804, A6NKK7, Q96FC5
Gene ID:
Human(5995) Summary: This gene encodes a putative retinal G-protein coupled receptor. The gene is a member of the opsin subfamily of the 7 transmembrane, G-protein coupled receptor 1 family. Like other opsins which bind retinaldehyde, it contains a conserved lysine residue in the seventh transmembrane domain. The protein acts as a photoisomerase to catalyze the conversion of all-trans-retinal to 11-cis-retinal. The reverse isomerization occurs with rhodopsin in retinal photoreceptor cells. The protein is exclusively expressed in tissue adjacent to retinal photoreceptor cells, the retinal pigment epithelium and Mueller cells. This gene may be associated with autosomal recessive and autosomal dominant retinitis pigmentosa (arRP and adRP, respectively). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(57811) retinal G protein coupled receptor
Rat(306307) retinal G protein coupled receptor
domestic cat(101083036) retinal G protein coupled receptor
dog(489072) retinal G protein coupled receptor
chicken(423619) retinal G protein coupled receptor
naked mole-rat(101705893) retinal G protein coupled receptor
domestic guinea pig(100725184) retinal G protein coupled receptor
cow(280911) retinal G protein coupled receptor
sheep(101110564) retinal G protein coupled receptor
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002921 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021340 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021340 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021340 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124451 MISSION® esiRNA esiRNA human RGR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012720 Rosetta Predictions human pricing
NM_001012722 Rosetta Predictions human pricing
NM_002921 Rosetta Predictions human pricing
NM_001107299 Rosetta Predictions rat pricing
NM_021340 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188820 predicted 510
2 SASI_Hs01_00188822 predicted 1035
3 SASI_Hs01_00188823 predicted 888
4 SASI_Hs01_00188824 predicted 425
5 SASI_Hs01_00188825 predicted 659
6 SASI_Hs01_00188826 predicted 1052
7 SASI_Hs01_00188827 predicted 117
8 SASI_Hs01_00188828 predicted 1042
9 SASI_Hs01_00188829 predicted 213
10 SASI_Hs02_00306225 predicted 717
11 SASI_Hs01_00188821 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097328 predicted 513
2 SASI_Hs01_00097330 predicted 770
3 SASI_Hs01_00097331 predicted 550
4 SASI_Hs01_00097332 predicted 431
5 SASI_Hs01_00097333 predicted 943
6 SASI_Hs01_00097334 predicted 692
7 SASI_Hs01_00097335 predicted 211
8 SASI_Hs01_00097336 predicted 704
9 SASI_Hs01_00097337 predicted 960
10 SASI_Hs02_00306226 predicted 239
11 SASI_Hs01_00097329 predicted 142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087728 predicted 520
2 SASI_Hs01_00087729 predicted 1051
3 SASI_Hs01_00087730 predicted 896
4 SASI_Hs01_00087731 predicted 440
5 SASI_Hs01_00087732 predicted 664
6 SASI_Hs01_00087733 predicted 1069
7 SASI_Hs01_00087735 predicted 258
8 SASI_Hs01_00087736 predicted 1052
9 SASI_Hs01_00087737 predicted 204
10 SASI_Hs02_00334750 predicted 728
11 SASI_Hs01_00087734 predicted 124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227475 predicted 1192
2 SASI_Rn02_00227476 predicted 541
3 SASI_Rn02_00227477 predicted 1013
4 SASI_Rn02_00227478 predicted 728
5 SASI_Rn02_00227479 predicted 1210
6 SASI_Rn02_00227480 predicted 1284
7 SASI_Rn02_00227481 predicted 1266
8 SASI_Rn02_00227482 predicted 1162
9 SASI_Rn02_00227483 predicted 1231
10 SASI_Rn02_00227484 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139307 predicted 537
2 SASI_Mm01_00139308 predicted 1068
3 SASI_Mm01_00139309 predicted 804
4 SASI_Mm01_00139310 predicted 926
5 SASI_Mm01_00139311 predicted 944
6 SASI_Mm01_00139312 predicted 1207
7 SASI_Mm01_00139313 predicted 1190
8 SASI_Mm01_00139314 predicted 1178
9 SASI_Mm01_00139315 predicted 723
10 SASI_Mm01_00139316 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002921
RGR MISSION shRNA Bacterial Glycerol Stock
retinal G protein coupled receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002921.3-729s21c1
Sequence:CCGGTATGCCATCCTGTATCTATACCTCGAGGTATAGATACAGGATGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002921.3-826s21c1
Sequence:CCGGCGATCAATGCCATCAACTATGCTCGAGCATAGTTGATGGCATTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002921.3-1250s21c1
Sequence:CCGGGTGTAACCATCACCCTAATAACTCGAGTTATTAGGGTGATGGTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002921.3-666s21c1
Sequence:CCGGAGTGGCCATCTCCAGGTAAACCTCGAGGTTTACCTGGAGATGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-795s1c1
Sequence:CCGGGCCCACGATCAATGCCATCAACTCGAGTTGATGGCATTGATCGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-555s1c1
Sequence:CCGGCTTCACCATGTCCTTCTTCAACTCGAGTTGAAGAAGGACATGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-711s1c1
Sequence:CCGGCCTGTATCTATACGCAGTCATCTCGAGATGACTGCGTATAGATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-700s1c1
Sequence:CCGGCCCTATGCCATCCTGTATCTACTCGAGTAGATACAGGATGGCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002921.2-1364s1c1
Sequence:CCGGCCCACTTACAAGTGAGAACATCTCGAGATGTTCTCACTTGTAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002921
RGR MISSION shRNA shRNA Plasmid DNA
retinal G protein coupled receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002921.3-729s21c1
Sequence:CCGGTATGCCATCCTGTATCTATACCTCGAGGTATAGATACAGGATGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002921.3-826s21c1
Sequence:CCGGCGATCAATGCCATCAACTATGCTCGAGCATAGTTGATGGCATTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002921.3-1250s21c1
Sequence:CCGGGTGTAACCATCACCCTAATAACTCGAGTTATTAGGGTGATGGTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002921.3-666s21c1
Sequence:CCGGAGTGGCCATCTCCAGGTAAACCTCGAGGTTTACCTGGAGATGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-795s1c1
Sequence:CCGGGCCCACGATCAATGCCATCAACTCGAGTTGATGGCATTGATCGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-555s1c1
Sequence:CCGGCTTCACCATGTCCTTCTTCAACTCGAGTTGAAGAAGGACATGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-711s1c1
Sequence:CCGGCCTGTATCTATACGCAGTCATCTCGAGATGACTGCGTATAGATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-700s1c1
Sequence:CCGGCCCTATGCCATCCTGTATCTACTCGAGTAGATACAGGATGGCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002921.2-1364s1c1
Sequence:CCGGCCCACTTACAAGTGAGAACATCTCGAGATGTTCTCACTTGTAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002921
RGR MISSION shRNA Lentiviral Transduction Particles
retinal G protein coupled receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002921.3-729s21c1
Sequence:CCGGTATGCCATCCTGTATCTATACCTCGAGGTATAGATACAGGATGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002921.3-826s21c1
Sequence:CCGGCGATCAATGCCATCAACTATGCTCGAGCATAGTTGATGGCATTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002921.3-1250s21c1
Sequence:CCGGGTGTAACCATCACCCTAATAACTCGAGTTATTAGGGTGATGGTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002921.3-666s21c1
Sequence:CCGGAGTGGCCATCTCCAGGTAAACCTCGAGGTTTACCTGGAGATGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-795s1c1
Sequence:CCGGGCCCACGATCAATGCCATCAACTCGAGTTGATGGCATTGATCGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-555s1c1
Sequence:CCGGCTTCACCATGTCCTTCTTCAACTCGAGTTGAAGAAGGACATGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-711s1c1
Sequence:CCGGCCTGTATCTATACGCAGTCATCTCGAGATGACTGCGTATAGATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002921.2-700s1c1
Sequence:CCGGCCCTATGCCATCCTGTATCTACTCGAGTAGATACAGGATGGCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002921.2-1364s1c1
Sequence:CCGGCCCACTTACAAGTGAGAACATCTCGAGATGTTCTCACTTGTAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021340
RGR MISSION shRNA Bacterial Glycerol Stock
retinal G protein coupled receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-307s1c1
Sequence:CCGGGTTCATGGTTTCCAGGGATTTCTCGAGAAATCCCTGGAAACCATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-819s1c1
Sequence:CCGGCAACGCCATCAACTATGCGTTCTCGAGAACGCATAGTTGATGGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-518s1c1
Sequence:CCGGCATGCTGTACACTGGACTATTCTCGAGAATAGTCCAGTGTACAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-664s1c1
Sequence:CCGGCTCCCGGTGAATACTACTCTTCTCGAGAAGAGTAGTATTCACCGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-754s1c1
Sequence:CCGGGTGAGCTTCATCTCTCCTAAACTCGAGTTTAGGAGAGATGAAGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021340
RGR MISSION shRNA shRNA Plasmid DNA
retinal G protein coupled receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-307s1c1
Sequence:CCGGGTTCATGGTTTCCAGGGATTTCTCGAGAAATCCCTGGAAACCATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-819s1c1
Sequence:CCGGCAACGCCATCAACTATGCGTTCTCGAGAACGCATAGTTGATGGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-518s1c1
Sequence:CCGGCATGCTGTACACTGGACTATTCTCGAGAATAGTCCAGTGTACAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-664s1c1
Sequence:CCGGCTCCCGGTGAATACTACTCTTCTCGAGAAGAGTAGTATTCACCGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-754s1c1
Sequence:CCGGGTGAGCTTCATCTCTCCTAAACTCGAGTTTAGGAGAGATGAAGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021340
RGR MISSION shRNA Lentiviral Transduction Particles
retinal G protein coupled receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-307s1c1
Sequence:CCGGGTTCATGGTTTCCAGGGATTTCTCGAGAAATCCCTGGAAACCATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-819s1c1
Sequence:CCGGCAACGCCATCAACTATGCGTTCTCGAGAACGCATAGTTGATGGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-518s1c1
Sequence:CCGGCATGCTGTACACTGGACTATTCTCGAGAATAGTCCAGTGTACAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-664s1c1
Sequence:CCGGCTCCCGGTGAATACTACTCTTCTCGAGAAGAGTAGTATTCACCGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021340.2-754s1c1
Sequence:CCGGGTGAGCTTCATCTCTCCTAAACTCGAGTTTAGGAGAGATGAAGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks