EMAIL THIS PAGE TO A FRIEND

RGS11

regulator of G-protein signaling 11

Synonyms: RS11
UniProtKB ID: O94810, O75883, Q4TT71, Q4TT72
Gene ID:
Human(8786) Summary: The protein encoded by this gene belongs to the RGS (regulator of G protein signaling) family. Members of the RGS family act as GTPase-activating proteins on the alpha subunits of heterotrimeric, signal-transducing G proteins. This protein inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(50782) regulator of G-protein signaling 11
Rat(54291) regulator of G-protein signaling 11
Zebrafish(559197) regulator of G-protein signaling 11
dog(611545) regulator of G-protein signaling 11
domestic cat(101096530) regulator of G-protein signaling 11
chicken(395621) regulator of G-protein signaling 11
cow(521040) regulator of G-protein signaling 11
sheep(101121907) regulator of G-protein signaling 11
domestic guinea pig(100717975) regulator of G-protein signaling 11
naked mole-rat(101702566) regulator of G-protein signaling 11
Domestic Rabbit(100341920) regulator of G-protein signaling 11
178 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003834 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061261 MISSION® esiRNA esiRNA human RGS11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003834 Rosetta Predictions human pricing
NM_183337 Rosetta Predictions human pricing
XM_001062856 Rosetta Predictions rat pricing
XM_573061 Rosetta Predictions rat pricing
NM_001081069 Rosetta Predictions mouse pricing
XM_128488 Rosetta Predictions mouse pricing
XM_899136 Rosetta Predictions mouse pricing
XM_899153 Rosetta Predictions mouse pricing
XM_899178 Rosetta Predictions mouse pricing
XM_899196 Rosetta Predictions mouse pricing
XM_899207 Rosetta Predictions mouse pricing
XM_899216 Rosetta Predictions mouse pricing
XM_899228 Rosetta Predictions mouse pricing
XM_899237 Rosetta Predictions mouse pricing
XM_899244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336392 predicted 960
2 SASI_Hs01_00018004 predicted 1778
3 SASI_Hs01_00018005 predicted 824
4 SASI_Hs01_00018006 predicted 1767
5 SASI_Hs01_00018007 predicted 1016
6 SASI_Hs02_00336393 predicted 1778
7 SASI_Hs02_00336394 predicted 1436
8 SASI_Hs01_00018011 predicted 1011
9 SASI_Hs01_00018012 predicted 948
10 SASI_Hs01_00018013 predicted 1004
11 SASI_Hs01_00018008 predicted 288
12 SASI_Hs01_00018009 predicted 1650
13 SASI_Hs01_00018010 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371259 predicted 956
2 SASI_Hs01_00086960 predicted 1768
3 SASI_Hs01_00086961 predicted 812
4 SASI_Hs01_00086962 predicted 1749
5 SASI_Hs01_00086963 predicted 1001
6 SASI_Hs02_00371260 predicted 1768
7 SASI_Hs02_00371261 predicted 1417
8 SASI_Hs01_00086967 predicted 1004
9 SASI_Hs01_00086968 predicted 940
10 SASI_Hs01_00086969 predicted 989
11 SASI_Hs01_00086964 predicted 285
12 SASI_Hs01_00086965 predicted 1648
13 SASI_Hs01_00086966 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304837 predicted 1450
2 SASI_Rn02_00304838 predicted 466
3 SASI_Rn02_00304839 predicted 1530
4 SASI_Rn02_00304840 predicted 365
5 SASI_Rn02_00304841 predicted 848
6 SASI_Rn02_00304842 predicted 505
7 SASI_Rn02_00304843 predicted 1490
8 SASI_Rn02_00304844 predicted 1199
9 SASI_Rn02_00304845 predicted 1170
10 SASI_Rn02_00304846 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399716 predicted 575
2 SASI_Rn02_00399717 predicted 1223
3 SASI_Rn02_00399718 predicted 698
4 SASI_Rn02_00399719 predicted 1186
5 SASI_Rn02_00399720 predicted 396
6 SASI_Rn02_00399721 predicted 467
7 SASI_Rn02_00399722 predicted 612
8 SASI_Rn02_00399723 predicted 751
9 SASI_Rn02_00399724 predicted 374
10 SASI_Rn02_00399725 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294871 predicted 570
2 SASI_Mm02_00294872 predicted 1459
3 SASI_Mm02_00294873 predicted 659
4 SASI_Mm02_00294874 predicted 970
5 SASI_Mm02_00294875 predicted 1297
6 SASI_Mm02_00294876 predicted 577
7 SASI_Mm02_00294877 predicted 544
8 SASI_Mm02_00294878 predicted 1227
9 SASI_Mm02_00294879 predicted 1296
10 SASI_Mm02_00294880 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204972 predicted 1741
2 SASI_Mm01_00204973 predicted 1728
3 SASI_Mm01_00204974 predicted 1631
4 SASI_Mm01_00204975 predicted 1742
5 SASI_Mm01_00204976 predicted 1624
6 SASI_Mm01_00204977 predicted 1645
7 SASI_Mm01_00204978 predicted 1739
8 SASI_Mm01_00204979 predicted 1770
9 SASI_Mm01_00204980 predicted 1653
10 SASI_Mm01_00204981 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283436 predicted 471
2 SASI_Mm01_00283437 predicted 462
3 SASI_Mm01_00283438 predicted 203
4 SASI_Mm01_00283439 predicted 238
5 SASI_Mm01_00283440 predicted 459
6 SASI_Mm01_00283441 predicted 258
7 SASI_Mm01_00283442 predicted 301
8 SASI_Mm01_00283443 predicted 240
9 SASI_Mm01_00283444 predicted 254
10 SASI_Mm01_00283445 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223112 predicted 1381
2 SASI_Mm01_00223113 predicted 1402
3 SASI_Mm01_00223114 predicted 1393
4 SASI_Mm01_00223115 predicted 1930
5 SASI_Mm01_00223116 predicted 1166
6 SASI_Mm01_00223117 predicted 1365
7 SASI_Mm01_00223118 predicted 1337
8 SASI_Mm01_00223119 predicted 1359
9 SASI_Mm01_00223120 predicted 1418
10 SASI_Mm01_00223121 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250052 predicted 621
2 SASI_Mm01_00250053 predicted 405
3 SASI_Mm01_00250054 predicted 402
4 SASI_Mm01_00250055 predicted 465
5 SASI_Mm01_00250056 predicted 682
6 SASI_Mm01_00250057 predicted 454
7 SASI_Mm01_00250058 predicted 460
8 SASI_Mm01_00250059 predicted 562
9 SASI_Mm01_00250060 predicted 537
10 SASI_Mm01_00250061 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270288 predicted 984
2 SASI_Mm01_00270289 predicted 978
3 SASI_Mm01_00270290 predicted 870
4 SASI_Mm01_00270291 predicted 985
5 SASI_Mm01_00270292 predicted 873
6 SASI_Mm01_00270293 predicted 888
7 SASI_Mm01_00270294 predicted 985
8 SASI_Mm01_00270295 predicted 1012
9 SASI_Mm01_00270296 predicted 896
10 SASI_Mm01_00270297 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232971 predicted 1075
2 SASI_Mm01_00232972 predicted 1066
3 SASI_Mm01_00232973 predicted 961
4 SASI_Mm01_00232974 predicted 1076
5 SASI_Mm01_00232975 predicted 965
6 SASI_Mm01_00232976 predicted 975
7 SASI_Mm01_00232977 predicted 1079
8 SASI_Mm01_00232978 predicted 1109
9 SASI_Mm01_00232979 predicted 999
10 SASI_Mm01_00232980 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221574 predicted 1714
2 SASI_Mm01_00221575 predicted 1703
3 SASI_Mm01_00221576 predicted 1604
4 SASI_Mm01_00221577 predicted 1711
5 SASI_Mm01_00221578 predicted 1605
6 SASI_Mm01_00221579 predicted 1622
7 SASI_Mm01_00221580 predicted 1717
8 SASI_Mm01_00221581 predicted 1737
9 SASI_Mm01_00221582 predicted 1634
10 SASI_Mm01_00221583 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213856 predicted 1783
2 SASI_Mm01_00213857 predicted 1767
3 SASI_Mm01_00213858 predicted 1669
4 SASI_Mm01_00213859 predicted 1781
5 SASI_Mm01_00213860 predicted 1664
6 SASI_Mm01_00213861 predicted 1680
7 SASI_Mm01_00213862 predicted 1781
8 SASI_Mm01_00213863 predicted 1802
9 SASI_Mm01_00213864 predicted 1694
10 SASI_Mm01_00213865 predicted 1761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225268 predicted 2445
2 SASI_Mm01_00225269 predicted 2432
3 SASI_Mm01_00225270 predicted 2326
4 SASI_Mm01_00225271 predicted 2439
5 SASI_Mm01_00225272 predicted 2331
6 SASI_Mm01_00225273 predicted 2348
7 SASI_Mm01_00225274 predicted 2435
8 SASI_Mm01_00225275 predicted 2472
9 SASI_Mm01_00225276 predicted 2366
10 SASI_Mm01_00225277 predicted 2418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209441 predicted 2357
2 SASI_Mm01_00209442 predicted 2353
3 SASI_Mm01_00209443 predicted 2251
4 SASI_Mm01_00209444 predicted 2357
5 SASI_Mm01_00209445 predicted 2243
6 SASI_Mm01_00209446 predicted 2262
7 SASI_Mm01_00209447 predicted 2355
8 SASI_Mm01_00209448 predicted 2392
9 SASI_Mm01_00209449 predicted 2282
10 SASI_Mm01_00209450 predicted 2337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128488
RGS11 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-1201s1c1
Sequence:CCGGGCTTCACATCTACATGCTCATCTCGAGATGAGCATGTAGATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-208s1c1
Sequence:CCGGGCTGGTTCAGAAGTTCTGCATCTCGAGATGCAGAACTTCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-690s1c1
Sequence:CCGGCGGATTTCTATAAGTGTGAGACTCGAGTCTCACACTTATAGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-1312s1c1
Sequence:CCGGGCCATTTCCATTCTTGCGGAACTCGAGTTCCGCAAGAATGGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-152s1c1
Sequence:CCGGCGCCTTCTGATCACTGTCATTCTCGAGAATGACAGTGATCAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128488
RGS11 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-1201s1c1
Sequence:CCGGGCTTCACATCTACATGCTCATCTCGAGATGAGCATGTAGATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-208s1c1
Sequence:CCGGGCTGGTTCAGAAGTTCTGCATCTCGAGATGCAGAACTTCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-690s1c1
Sequence:CCGGCGGATTTCTATAAGTGTGAGACTCGAGTCTCACACTTATAGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-1312s1c1
Sequence:CCGGGCCATTTCCATTCTTGCGGAACTCGAGTTCCGCAAGAATGGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-152s1c1
Sequence:CCGGCGCCTTCTGATCACTGTCATTCTCGAGAATGACAGTGATCAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128488
RGS11 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-1201s1c1
Sequence:CCGGGCTTCACATCTACATGCTCATCTCGAGATGAGCATGTAGATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-208s1c1
Sequence:CCGGGCTGGTTCAGAAGTTCTGCATCTCGAGATGCAGAACTTCTGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-690s1c1
Sequence:CCGGCGGATTTCTATAAGTGTGAGACTCGAGTCTCACACTTATAGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-1312s1c1
Sequence:CCGGGCCATTTCCATTCTTGCGGAACTCGAGTTCCGCAAGAATGGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128488.3-152s1c1
Sequence:CCGGCGCCTTCTGATCACTGTCATTCTCGAGAATGACAGTGATCAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003834
RGS11 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003834.1-1769s1c1
Sequence:CCGGCCAGTAAATCAGCCAGCGAATCTCGAGATTCGCTGGCTGATTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-432s1c1
Sequence:CCGGGATTATGAGAAGGACTGCTATCTCGAGATAGCAGTCCTTCTCATAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-1193s1c1
Sequence:CCGGGCTGCACATATACATGCTCATCTCGAGATGAGCATGTATATGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-668s1c1
Sequence:CCGGCATGACCAAGAGTGCAGATTTCTCGAGAAATCTGCACTCTTGGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-1017s1c1
Sequence:CCGGGCATGTGAGGAGCTTCGATATCTCGAGATATCGAAGCTCCTCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003834.1-1452s21c1
Sequence:CCGGAGCTCAACGTCCTGCGTGAATCTCGAGATTCACGCAGGACGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003834.1-850s21c1
Sequence:CCGGACGCCTACTGGGTCATGAATGCTCGAGCATTCATGACCCAGTAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003834.1-1297s21c1
Sequence:CCGGAGAGACGCGTGTTCCCGTTTACTCGAGTAAACGGGAACACGCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003834.1-692s21c1
Sequence:CCGGTAAGCGGGAGATCGAGTACTTCTCGAGAAGTACTCGATCTCCCGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003834
RGS11 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003834.1-1769s1c1
Sequence:CCGGCCAGTAAATCAGCCAGCGAATCTCGAGATTCGCTGGCTGATTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-432s1c1
Sequence:CCGGGATTATGAGAAGGACTGCTATCTCGAGATAGCAGTCCTTCTCATAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-1193s1c1
Sequence:CCGGGCTGCACATATACATGCTCATCTCGAGATGAGCATGTATATGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-668s1c1
Sequence:CCGGCATGACCAAGAGTGCAGATTTCTCGAGAAATCTGCACTCTTGGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-1017s1c1
Sequence:CCGGGCATGTGAGGAGCTTCGATATCTCGAGATATCGAAGCTCCTCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003834.1-1452s21c1
Sequence:CCGGAGCTCAACGTCCTGCGTGAATCTCGAGATTCACGCAGGACGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003834.1-850s21c1
Sequence:CCGGACGCCTACTGGGTCATGAATGCTCGAGCATTCATGACCCAGTAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003834.1-1297s21c1
Sequence:CCGGAGAGACGCGTGTTCCCGTTTACTCGAGTAAACGGGAACACGCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003834.1-692s21c1
Sequence:CCGGTAAGCGGGAGATCGAGTACTTCTCGAGAAGTACTCGATCTCCCGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003834
RGS11 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003834.1-1769s1c1
Sequence:CCGGCCAGTAAATCAGCCAGCGAATCTCGAGATTCGCTGGCTGATTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-432s1c1
Sequence:CCGGGATTATGAGAAGGACTGCTATCTCGAGATAGCAGTCCTTCTCATAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-1193s1c1
Sequence:CCGGGCTGCACATATACATGCTCATCTCGAGATGAGCATGTATATGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-668s1c1
Sequence:CCGGCATGACCAAGAGTGCAGATTTCTCGAGAAATCTGCACTCTTGGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003834.1-1017s1c1
Sequence:CCGGGCATGTGAGGAGCTTCGATATCTCGAGATATCGAAGCTCCTCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003834.1-1452s21c1
Sequence:CCGGAGCTCAACGTCCTGCGTGAATCTCGAGATTCACGCAGGACGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003834.1-850s21c1
Sequence:CCGGACGCCTACTGGGTCATGAATGCTCGAGCATTCATGACCCAGTAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003834.1-1297s21c1
Sequence:CCGGAGAGACGCGTGTTCCCGTTTACTCGAGTAAACGGGAACACGCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003834.1-692s21c1
Sequence:CCGGTAAGCGGGAGATCGAGTACTTCTCGAGAAGTACTCGATCTCCCGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks