EMAIL THIS PAGE TO A FRIEND

RGS20

regulator of G-protein signaling 20

Synonyms: RGSZ1 ZGAP1
UniProtKB ID: O76081, Q96BG9
Gene ID:
Human(8601) Summary: The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(58175) regulator of G-protein signaling 20
Rat(362477) regulator of G-protein signaling 20
naked mole-rat(101724487) regulator of G-protein signaling 20
domestic guinea pig(100716241) regulator of G-protein signaling 20
cow(614441) regulator of G-protein signaling 20
sheep(101113942) regulator of G-protein signaling 20
Zebrafish(436704) regulator of G-protein signaling 20
chicken(395646) regulator of G-protein signaling 20
dog(486954) regulator of G-protein signaling 20
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003702 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042371 MISSION® esiRNA esiRNA targeting mouse Rgs20 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003702 Rosetta Predictions human pricing
NM_170587 Rosetta Predictions human pricing
NM_001127495 Rosetta Predictions rat pricing
NM_021374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057667 predicted 496
2 SASI_Hs01_00057668 predicted 504
3 SASI_Hs01_00057669 predicted 510
4 SASI_Hs01_00057670 predicted 504
5 SASI_Hs01_00057671 predicted 515
6 SASI_Hs01_00057672 predicted 519
7 SASI_Hs01_00057673 predicted 499
8 SASI_Hs01_00057674 predicted 517
9 SASI_Hs01_00057675 predicted 496
10 SASI_Hs01_00057676 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193288 predicted 1020
2 SASI_Hs01_00193289 predicted 1032
3 SASI_Hs01_00193290 predicted 1032
4 SASI_Hs01_00193291 predicted 1021
5 SASI_Hs01_00193292 predicted 1038
6 SASI_Hs01_00193293 predicted 1041
7 SASI_Hs01_00193294 predicted 1020
8 SASI_Hs01_00193295 predicted 1041
9 SASI_Hs01_00193296 predicted 1017
10 SASI_Hs01_00193297 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253913 predicted 1306
2 SASI_Rn02_00253914 predicted 1046
3 SASI_Rn02_00253915 predicted 530
4 SASI_Rn02_00253916 predicted 817
5 SASI_Rn02_00253917 predicted 948
6 SASI_Rn02_00253918 predicted 1334
7 SASI_Rn02_00253919 predicted 1389
8 SASI_Rn02_00253920 predicted 516
9 SASI_Rn02_00253921 predicted 1386
10 SASI_Rn02_00253922 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325962 predicted 499
2 SASI_Mm01_00194790 predicted 591
3 SASI_Mm02_00325963 predicted 663
4 SASI_Mm01_00194792 predicted 542
5 SASI_Mm01_00194794 predicted 368
6 SASI_Mm01_00194796 predicted 680
7 SASI_Mm01_00194798 predicted 610
8 SASI_Mm02_00325964 predicted 301
9 SASI_Mm02_00325965 predicted 309
10 SASI_Mm02_00325966 predicted 533
11 SASI_Mm01_00194789 predicted 709
12 SASI_Mm01_00194791 predicted 431
13 SASI_Mm01_00194793 predicted 533
14 SASI_Mm01_00194795 predicted 513
15 SASI_Mm01_00194797 predicted 597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003702
RGS20 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003702.3-619s21c1
Sequence:CCGGAGAAAGCAAGGATAATCTATGCTCGAGCATAGATTATCCTTGCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003702.3-944s21c1
Sequence:CCGGCATCTTCTGCTGGAGTAATACCTCGAGGTATTACTCCAGCAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003702.3-797s21c1
Sequence:CCGGCATGAACTCTGCTGTCTATAACTCGAGTTATAGACAGCAGAGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003702.2-1434s1c1
Sequence:CCGGGCCAACCTAAAGAATGAATTTCTCGAGAAATTCATTCTTTAGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-223s1c1
Sequence:CCGGGCTCGTGTCTCACTGTTAGAACTCGAGTTCTAACAGTGAGACACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-715s1c1
Sequence:CCGGCGGAGAAATCTATTGAAGCATCTCGAGATGCTTCAATAGATTTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-348s1c1
Sequence:CCGGGCTCAGTCATTTGACAAATTACTCGAGTAATTTGTCAAATGACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-600s1c1
Sequence:CCGGCCATCCCAACACATATTCGATCTCGAGATCGAATATGTGTTGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003702
RGS20 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003702.3-619s21c1
Sequence:CCGGAGAAAGCAAGGATAATCTATGCTCGAGCATAGATTATCCTTGCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003702.3-944s21c1
Sequence:CCGGCATCTTCTGCTGGAGTAATACCTCGAGGTATTACTCCAGCAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003702.3-797s21c1
Sequence:CCGGCATGAACTCTGCTGTCTATAACTCGAGTTATAGACAGCAGAGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003702.2-1434s1c1
Sequence:CCGGGCCAACCTAAAGAATGAATTTCTCGAGAAATTCATTCTTTAGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-223s1c1
Sequence:CCGGGCTCGTGTCTCACTGTTAGAACTCGAGTTCTAACAGTGAGACACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-715s1c1
Sequence:CCGGCGGAGAAATCTATTGAAGCATCTCGAGATGCTTCAATAGATTTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-348s1c1
Sequence:CCGGGCTCAGTCATTTGACAAATTACTCGAGTAATTTGTCAAATGACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-600s1c1
Sequence:CCGGCCATCCCAACACATATTCGATCTCGAGATCGAATATGTGTTGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003702
RGS20 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003702.3-619s21c1
Sequence:CCGGAGAAAGCAAGGATAATCTATGCTCGAGCATAGATTATCCTTGCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003702.3-944s21c1
Sequence:CCGGCATCTTCTGCTGGAGTAATACCTCGAGGTATTACTCCAGCAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003702.3-797s21c1
Sequence:CCGGCATGAACTCTGCTGTCTATAACTCGAGTTATAGACAGCAGAGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003702.2-1434s1c1
Sequence:CCGGGCCAACCTAAAGAATGAATTTCTCGAGAAATTCATTCTTTAGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-223s1c1
Sequence:CCGGGCTCGTGTCTCACTGTTAGAACTCGAGTTCTAACAGTGAGACACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-715s1c1
Sequence:CCGGCGGAGAAATCTATTGAAGCATCTCGAGATGCTTCAATAGATTTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-348s1c1
Sequence:CCGGGCTCAGTCATTTGACAAATTACTCGAGTAATTTGTCAAATGACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003702.2-600s1c1
Sequence:CCGGCCATCCCAACACATATTCGATCTCGAGATCGAATATGTGTTGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021374
VALIDATED
RGS20 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-444s1c1
Sequence:CCGGCGAACAGAATTCAGTGAAGAACTCGAGTTCTTCACTGAATTCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-734s1c1
Sequence:CCGGGCTTACGTCCTTAGCTGAGAACTCGAGTTCTCAGCTAAGGACGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-633s1c1
Sequence:CCGGCCATCCCAGCACATATTCGATCTCGAGATCGAATATGTGCTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-307s1c1
Sequence:CCGGCCCATGAAATCAGAACAGACACTCGAGTGTCTGTTCTGATTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-713s1c1
Sequence:CCGGCTCCACAGTCTATAAGGATTTCTCGAGAAATCCTTATAGACTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021374
VALIDATED
RGS20 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-444s1c1
Sequence:CCGGCGAACAGAATTCAGTGAAGAACTCGAGTTCTTCACTGAATTCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-734s1c1
Sequence:CCGGGCTTACGTCCTTAGCTGAGAACTCGAGTTCTCAGCTAAGGACGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-633s1c1
Sequence:CCGGCCATCCCAGCACATATTCGATCTCGAGATCGAATATGTGCTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-307s1c1
Sequence:CCGGCCCATGAAATCAGAACAGACACTCGAGTGTCTGTTCTGATTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-713s1c1
Sequence:CCGGCTCCACAGTCTATAAGGATTTCTCGAGAAATCCTTATAGACTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021374
VALIDATED
RGS20 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-444s1c1
Sequence:CCGGCGAACAGAATTCAGTGAAGAACTCGAGTTCTTCACTGAATTCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-734s1c1
Sequence:CCGGGCTTACGTCCTTAGCTGAGAACTCGAGTTCTCAGCTAAGGACGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-633s1c1
Sequence:CCGGCCATCCCAGCACATATTCGATCTCGAGATCGAATATGTGCTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-307s1c1
Sequence:CCGGCCCATGAAATCAGAACAGACACTCGAGTGTCTGTTCTGATTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021374.1-713s1c1
Sequence:CCGGCTCCACAGTCTATAAGGATTTCTCGAGAAATCCTTATAGACTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks