EMAIL THIS PAGE TO A FRIEND

RGS6

regulator of G-protein signaling 6

Synonyms: GAP
Gene ID:
Human(9628) Summary: This gene encodes a member of the RGS (regulator of G protein signaling) family of proteins, which are defined by the presence of a RGS domain that confers the GTPase-activating activity of these proteins toward certain G alpha subunits. This protein also belongs to a subfamily of RGS proteins characterized by the presence of DEP and GGL domains, the latter a G beta 5-interacting domain. The RGS proteins negatively regulate G protein signaling, and may modulate neuronal, cardiovascular, lymphocytic activities, and cancer risk. Many alternatively spliced transcript variants encoding different isoforms with long or short N-terminal domains, complete or incomplete GGL domains, and distinct C-terminal domains, have been described for this gene, however, the full-length nature of some of these variants is not known.[provided by RefSeq, Mar 2011]
Mouse(50779) regulator of G-protein signaling 6
Rat(54295) regulator of G-protein signaling 6
Zebrafish(562667) regulator of G-protein signalling 6
chicken(395618) regulator of G-protein signaling 6
dog(480380) regulator of G-protein signaling 6
domestic cat(101083183) regulator of G-protein signaling 6
Horse(100055109) regulator of G-protein signaling 6
naked mole-rat(101721173) regulator of G-protein signaling 6
domestic guinea pig(100717284) regulator of G-protein signaling 6
cow(517545) regulator of G-protein signaling 6
sheep(101122698) regulator of G-protein signaling 6
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004296 Rosetta Predictions human pricing
XM_001056086 Rosetta Predictions rat pricing
XM_001056155 Rosetta Predictions rat pricing
XM_001063200 Rosetta Predictions rat pricing
XM_345702 Rosetta Predictions rat pricing
NM_015812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139759 predicted 303
2 SASI_Hs01_00139760 predicted 1099
3 SASI_Hs01_00139761 predicted 1131
4 SASI_Hs01_00139763 predicted 357
5 SASI_Hs01_00139764 predicted 313
6 SASI_Hs01_00139765 predicted 1447
7 SASI_Hs01_00139766 predicted 1256
8 SASI_Hs02_00337310 predicted 1084
9 SASI_Hs01_00139767 predicted 638
10 SASI_Hs01_00139768 predicted 985
11 SASI_Hs01_00139762 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281944 predicted 581
2 SASI_Rn02_00281945 predicted 956
3 SASI_Rn02_00281946 predicted 1197
4 SASI_Rn02_00281947 predicted 1278
5 SASI_Rn02_00281948 predicted 1131
6 SASI_Rn02_00281949 predicted 627
7 SASI_Rn02_00281950 predicted 301
8 SASI_Rn02_00281951 predicted 317
9 SASI_Rn02_00281952 predicted 995
10 SASI_Rn02_00281953 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282264 predicted 861
2 SASI_Rn02_00282265 predicted 1248
3 SASI_Rn02_00282266 predicted 1481
4 SASI_Rn02_00282267 predicted 1562
5 SASI_Rn02_00282268 predicted 1411
6 SASI_Rn02_00282269 predicted 468
7 SASI_Rn02_00282270 predicted 910
8 SASI_Rn02_00282271 predicted 582
9 SASI_Rn02_00282272 predicted 607
10 SASI_Rn02_00282273 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306227 predicted 296
2 SASI_Rn02_00306228 predicted 1209
3 SASI_Rn02_00306229 predicted 1148
4 SASI_Rn02_00306230 predicted 1091
5 SASI_Rn02_00306231 predicted 628
6 SASI_Rn02_00306232 predicted 209
7 SASI_Rn02_00306233 predicted 812
8 SASI_Rn02_00306234 predicted 929
9 SASI_Rn02_00306235 predicted 951
10 SASI_Rn02_00306236 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159810 predicted 2878
2 SASI_Rn01_00159811 predicted 3099
3 SASI_Rn01_00159812 predicted 2319
4 SASI_Rn01_00159813 predicted 5445
5 SASI_Rn01_00159814 predicted 4083
6 SASI_Rn01_00159815 predicted 4417
7 SASI_Rn01_00159816 predicted 3403
8 SASI_Rn01_00159817 predicted 4045
9 SASI_Rn01_00159818 predicted 3633
10 SASI_Rn01_00159819 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052077 predicted 1294
2 SASI_Mm01_00052078 predicted 771
3 SASI_Mm01_00052079 predicted 1280
4 SASI_Mm01_00052080 predicted 470
5 SASI_Mm01_00052081 predicted 1418
6 SASI_Mm01_00052082 predicted 607
7 SASI_Mm01_00052083 predicted 1559
8 SASI_Mm01_00052084 predicted 1029
9 SASI_Mm01_00052085 predicted 578
10 SASI_Mm01_00052086 predicted 1276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004296
RGS6 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004296.4-1998s21c1
Sequence:CCGGCACGACTATCACTTGAGATTACTCGAGTAATCTCAAGTGATAGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-1424s1c1
Sequence:CCGGGCTATGAGATAACCAGTCAAACTCGAGTTTGACTGGTTATCTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004296.3-2086s1c1
Sequence:CCGGCCATAGTTACAGCCACTACATCTCGAGATGTAGTGGCTGTAACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-1208s1c1
Sequence:CCGGGCTTCTCTTTCGATGAGATATCTCGAGATATCTCATCGAAAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-945s1c1
Sequence:CCGGGCATGTACTCAGCCAACCAATCTCGAGATTGGTTGGCTGAGTACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-868s1c1
Sequence:CCGGCGACGTTTGAAGAATCCACAACTCGAGTTGTGGATTCTTCAAACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004296
RGS6 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004296.4-1998s21c1
Sequence:CCGGCACGACTATCACTTGAGATTACTCGAGTAATCTCAAGTGATAGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-1424s1c1
Sequence:CCGGGCTATGAGATAACCAGTCAAACTCGAGTTTGACTGGTTATCTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004296.3-2086s1c1
Sequence:CCGGCCATAGTTACAGCCACTACATCTCGAGATGTAGTGGCTGTAACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-1208s1c1
Sequence:CCGGGCTTCTCTTTCGATGAGATATCTCGAGATATCTCATCGAAAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-945s1c1
Sequence:CCGGGCATGTACTCAGCCAACCAATCTCGAGATTGGTTGGCTGAGTACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-868s1c1
Sequence:CCGGCGACGTTTGAAGAATCCACAACTCGAGTTGTGGATTCTTCAAACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004296
RGS6 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004296.4-1998s21c1
Sequence:CCGGCACGACTATCACTTGAGATTACTCGAGTAATCTCAAGTGATAGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-1424s1c1
Sequence:CCGGGCTATGAGATAACCAGTCAAACTCGAGTTTGACTGGTTATCTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004296.3-2086s1c1
Sequence:CCGGCCATAGTTACAGCCACTACATCTCGAGATGTAGTGGCTGTAACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-1208s1c1
Sequence:CCGGGCTTCTCTTTCGATGAGATATCTCGAGATATCTCATCGAAAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-945s1c1
Sequence:CCGGGCATGTACTCAGCCAACCAATCTCGAGATTGGTTGGCTGAGTACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004296.3-868s1c1
Sequence:CCGGCGACGTTTGAAGAATCCACAACTCGAGTTGTGGATTCTTCAAACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015812
RGS6 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-1028s1c1
Sequence:CCGGCGGCGTTTGAAGAATCCACAACTCGAGTTGTGGATTCTTCAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-1660s1c1
Sequence:CCGGGCTGATGAAGAGTGACAGCTACTCGAGTAGCTGTCACTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-1556s1c1
Sequence:CCGGCCAAGTGCAATCAACTTGGATCTCGAGATCCAAGTTGATTGCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-571s1c1
Sequence:CCGGGCTTATGAAGAACCTTTCCATCTCGAGATGGAAAGGTTCTTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-896s1c1
Sequence:CCGGCAAGTGAAGATTGACCGGAAACTCGAGTTTCCGGTCAATCTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015812
RGS6 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-1028s1c1
Sequence:CCGGCGGCGTTTGAAGAATCCACAACTCGAGTTGTGGATTCTTCAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-1660s1c1
Sequence:CCGGGCTGATGAAGAGTGACAGCTACTCGAGTAGCTGTCACTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-1556s1c1
Sequence:CCGGCCAAGTGCAATCAACTTGGATCTCGAGATCCAAGTTGATTGCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-571s1c1
Sequence:CCGGGCTTATGAAGAACCTTTCCATCTCGAGATGGAAAGGTTCTTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-896s1c1
Sequence:CCGGCAAGTGAAGATTGACCGGAAACTCGAGTTTCCGGTCAATCTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015812
RGS6 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-1028s1c1
Sequence:CCGGCGGCGTTTGAAGAATCCACAACTCGAGTTGTGGATTCTTCAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-1660s1c1
Sequence:CCGGGCTGATGAAGAGTGACAGCTACTCGAGTAGCTGTCACTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-1556s1c1
Sequence:CCGGCCAAGTGCAATCAACTTGGATCTCGAGATCCAAGTTGATTGCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-571s1c1
Sequence:CCGGGCTTATGAAGAACCTTTCCATCTCGAGATGGAAAGGTTCTTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015812.1-896s1c1
Sequence:CCGGCAAGTGAAGATTGACCGGAAACTCGAGTTTCCGGTCAATCTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks