EMAIL THIS PAGE TO A FRIEND

RHBDD2

rhomboid domain containing 2

Synonyms: NPD007 RHBDL7
UniProtKB ID: Q6NTF9, Q7L534, Q9H5W6, Q9UDT2
Gene ID:
Mouse(215160) rhomboid domain containing 2
Rat(360793) rhomboid domain containing 2
domestic guinea pig(100728805) rhomboid domain containing 2
naked mole-rat(101711974) rhomboid domain containing 2
cow(540447) rhomboid domain containing 2
sheep(101117813) rhomboid domain containing 2
Zebrafish(100004922) rhomboid domain containing 2
chicken(417521) rhomboid domain containing 2
dog(489815) rhomboid domain containing 2
domestic cat(101086025) rhomboid domain containing 2
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146002 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146002 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146002 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020684 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135361 MISSION® esiRNA esiRNA human RHBDD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040456 Rosetta Predictions human pricing
NM_001040457 Rosetta Predictions human pricing
XM_001077358 Rosetta Predictions rat pricing
XM_341058 Rosetta Predictions rat pricing
NM_146002 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149654 predicted 622
2 SASI_Hs01_00149655 predicted 619
3 SASI_Hs02_00309000 predicted 752
4 SASI_Hs01_00149656 predicted 668
5 SASI_Hs01_00149657 predicted 670
6 SASI_Hs01_00149658 predicted 750
7 SASI_Hs01_00149659 predicted 953
8 SASI_Hs01_00149661 predicted 737
9 SASI_Hs01_00149662 predicted 999
10 SASI_Hs01_00149663 predicted 672
11 SASI_Hs01_00149660 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227129 predicted 741
2 SASI_Hs01_00227130 predicted 737
3 SASI_Hs02_00309001 predicted 871
4 SASI_Hs01_00227131 predicted 789
5 SASI_Hs01_00227132 predicted 790
6 SASI_Hs01_00227133 predicted 874
7 SASI_Hs01_00227134 predicted 1072
8 SASI_Hs01_00227136 predicted 864
9 SASI_Hs01_00227137 predicted 1126
10 SASI_Hs01_00227138 predicted 798
11 SASI_Hs01_00227135 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356770 predicted 304
2 SASI_Rn02_00356771 predicted 1443
3 SASI_Rn02_00356772 predicted 1383
4 SASI_Rn02_00356773 predicted 1246
5 SASI_Rn02_00356774 predicted 1448
6 SASI_Rn02_00356775 predicted 1243
7 SASI_Rn02_00356776 predicted 797
8 SASI_Rn02_00356777 predicted 1250
9 SASI_Rn02_00356778 predicted 447
10 SASI_Rn02_00356779 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392299 predicted 312
2 SASI_Rn02_00392300 predicted 1444
3 SASI_Rn02_00392301 predicted 1375
4 SASI_Rn02_00392302 predicted 1249
5 SASI_Rn02_00392303 predicted 1447
6 SASI_Rn02_00392304 predicted 1244
7 SASI_Rn02_00392305 predicted 797
8 SASI_Rn02_00392306 predicted 1256
9 SASI_Rn02_00392307 predicted 445
10 SASI_Rn02_00392308 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078213 predicted 272
2 SASI_Mm02_00341536 predicted 1207
3 SASI_Mm02_00341537 predicted 1494
4 SASI_Mm01_00078215 predicted 1344
5 SASI_Mm02_00341538 predicted 1403
6 SASI_Mm02_00341539 predicted 1216
7 SASI_Mm01_00078216 predicted 862
8 SASI_Mm01_00078217 predicted 413
9 SASI_Mm01_00078218 predicted 1315
10 SASI_Mm01_00078219 predicted 759
11 SASI_Mm01_00078214 predicted 783
12 SASI_Mm01_00078220 predicted 408
13 SASI_Mm01_00078221 predicted 399
14 SASI_Mm01_00078222 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146002
VALIDATED
RHBDD2 MISSION shRNA Bacterial Glycerol Stock
rhomboid domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-362s1c1
Sequence:CCGGGCCATCATCTACCTGTCATTTCTCGAGAAATGACAGGTAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-221s1c1
Sequence:CCGGGTGACCTACATCTTCGTCTATCTCGAGATAGACGAAGATGTAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-925s1c1
Sequence:CCGGCGGCCTGTGCTATGTGCAGAACTCGAGTTCTGCACATAGCACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146002.1-710s1c1
Sequence:CCGGCCCTTGTTCAAGTACATCTCACTCGAGTGAGATGTACTTGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-811s1c1
Sequence:CCGGCCCTCATCTGACTCCAAGTTACTCGAGTAACTTGGAGTCAGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146002
VALIDATED
RHBDD2 MISSION shRNA shRNA Plasmid DNA
rhomboid domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-362s1c1
Sequence:CCGGGCCATCATCTACCTGTCATTTCTCGAGAAATGACAGGTAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-221s1c1
Sequence:CCGGGTGACCTACATCTTCGTCTATCTCGAGATAGACGAAGATGTAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-925s1c1
Sequence:CCGGCGGCCTGTGCTATGTGCAGAACTCGAGTTCTGCACATAGCACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146002.1-710s1c1
Sequence:CCGGCCCTTGTTCAAGTACATCTCACTCGAGTGAGATGTACTTGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-811s1c1
Sequence:CCGGCCCTCATCTGACTCCAAGTTACTCGAGTAACTTGGAGTCAGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146002
VALIDATED
RHBDD2 MISSION shRNA Lentiviral Transduction Particles
rhomboid domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-362s1c1
Sequence:CCGGGCCATCATCTACCTGTCATTTCTCGAGAAATGACAGGTAGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-221s1c1
Sequence:CCGGGTGACCTACATCTTCGTCTATCTCGAGATAGACGAAGATGTAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-925s1c1
Sequence:CCGGCGGCCTGTGCTATGTGCAGAACTCGAGTTCTGCACATAGCACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146002.1-710s1c1
Sequence:CCGGCCCTTGTTCAAGTACATCTCACTCGAGTGAGATGTACTTGAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146002.1-811s1c1
Sequence:CCGGCCCTCATCTGACTCCAAGTTACTCGAGTAACTTGGAGTCAGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020684
VALIDATED
RHBDD2 MISSION shRNA Bacterial Glycerol Stock
rhomboid domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-1272s1c1
Sequence:CCGGCCCTAAGAGTCTCCTGACAAACTCGAGTTTGTCAGGAGACTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-465s1c1
Sequence:CCGGCGCTATCATCTTCCTGTCATTCTCGAGAATGACAGGAAGATGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-1050s1c1
Sequence:CCGGGCAGAACCACTTTGGTCCAAACTCGAGTTTGGACCAAAGTGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-724s1c1
Sequence:CCGGGCTCACCTACTGCTATTCCATCTCGAGATGGAATAGCAGTAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020684.2-297s1c1
Sequence:CCGGCCTTCGCAACTGGCAAGTTTACTCGAGTAAACTTGCCAGTTGCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020684
VALIDATED
RHBDD2 MISSION shRNA shRNA Plasmid DNA
rhomboid domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-1272s1c1
Sequence:CCGGCCCTAAGAGTCTCCTGACAAACTCGAGTTTGTCAGGAGACTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-465s1c1
Sequence:CCGGCGCTATCATCTTCCTGTCATTCTCGAGAATGACAGGAAGATGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-1050s1c1
Sequence:CCGGGCAGAACCACTTTGGTCCAAACTCGAGTTTGGACCAAAGTGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-724s1c1
Sequence:CCGGGCTCACCTACTGCTATTCCATCTCGAGATGGAATAGCAGTAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020684.2-297s1c1
Sequence:CCGGCCTTCGCAACTGGCAAGTTTACTCGAGTAAACTTGCCAGTTGCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020684
VALIDATED
RHBDD2 MISSION shRNA Lentiviral Transduction Particles
rhomboid domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-1272s1c1
Sequence:CCGGCCCTAAGAGTCTCCTGACAAACTCGAGTTTGTCAGGAGACTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-465s1c1
Sequence:CCGGCGCTATCATCTTCCTGTCATTCTCGAGAATGACAGGAAGATGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-1050s1c1
Sequence:CCGGGCAGAACCACTTTGGTCCAAACTCGAGTTTGGACCAAAGTGGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020684.2-724s1c1
Sequence:CCGGGCTCACCTACTGCTATTCCATCTCGAGATGGAATAGCAGTAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020684.2-297s1c1
Sequence:CCGGCCTTCGCAACTGGCAAGTTTACTCGAGTAAACTTGCCAGTTGCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks