EMAIL THIS PAGE TO A FRIEND

RHEB

Ras homolog enriched in brain

Synonyms: RHEB2
UniProtKB ID: Q15382, B3KWN6, D3DX13, Q53Y56, Q99444
Gene ID:
Human(6009) Summary: This gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. This protein is vital in regulation of growth and cell cycle progression due to its role in the insulin/TOR/S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of the protein is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22. [provided by RefSeq, Jul 2008]
Mouse(19744) Ras homolog enriched in brain
Rat(26954) Ras homolog enriched in brain
fruit fly(117332) CG1081 gene product from transcript CG1081-RA
domestic cat(101083160) Ras homolog enriched in brain
dog(475545) Ras homolog enriched in brain
chicken(420434) Ras homolog enriched in brain
Zebrafish(767781) ras homolog enriched in brain
domestic guinea pig(100734252) Ras homolog enriched in brain
naked mole-rat(101701441) Ras homolog enriched in brain
cow(528204) Ras homolog enriched in brain
sheep(100302069) Ras homolog enriched in brain
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS3499 Anti-Rheb (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
PRS3501 Anti-Rheb (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4200410 Anti-Rheb (C-terminal region) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody rat, human
immunofluorescence, western blot pricing
SAB4200517 Anti-Rheb (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB1409607 Anti-RHEB antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2104901 Anti-RHEB antibody produced in rabbit affinity isolated antibody mouse, horse, rat, goat, human, sheep, guinea pig, rabbit
western blot pricing
SAB1411194 Anti-RHEB antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0006009M5 Monoclonal Anti-RHEB antibody produced in mouse clone 1E12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404316 Monoclonal Anti-RHEB antibody produced in mouse clone 2C11, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005614 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005614 Rosetta Predictions human pricing
NM_013216 Rosetta Predictions rat pricing
NM_053075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066798 predicted 1014
2 SASI_Hs01_00066799 predicted 752
3 SASI_Hs01_00066800 predicted 643
4 SASI_Hs01_00066801 predicted 633
5 SASI_Hs01_00066802 predicted 1139
6 SASI_Hs01_00066803 predicted 1065
7 SASI_Hs01_00066804 predicted 798
8 SASI_Hs01_00066805 predicted 625
9 SASI_Hs01_00066806 predicted 1237
10 SASI_Hs01_00066807 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067891 predicted 247
2 SASI_Rn02_00261078 predicted 530
3 SASI_Rn01_00067893 predicted 359
4 SASI_Rn01_00067894 predicted 257
5 SASI_Rn01_00067895 predicted 337
6 SASI_Rn01_00067896 predicted 758
7 SASI_Rn02_00261079 predicted 308
8 SASI_Rn01_00067897 predicted 820
9 SASI_Rn01_00067898 predicted 714
10 SASI_Rn01_00067899 predicted 446
11 SASI_Rn01_00067892 predicted 640
12 SASI_Rn01_00067900 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131999 predicted 771
2 SASI_Mm01_00132000 predicted 338
3 SASI_Mm01_00132001 predicted 249
4 SASI_Mm01_00132002 predicted 260
5 SASI_Mm01_00132003 predicted 347
6 SASI_Mm01_00132005 predicted 208
7 SASI_Mm01_00132006 predicted 440
8 SASI_Mm01_00132007 predicted 725
9 SASI_Mm01_00132008 predicted 483
10 SASI_Mm02_00337545 predicted 453
11 SASI_Mm01_00132004 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005614
VALIDATED
RHEB MISSION shRNA Bacterial Glycerol Stock
Ras homolog enriched in brain
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005614.3-486s21c1
Sequence:CCGGCAATTTGTTGAAGGCCAATTTCTCGAGAAATTGGCCTTCAACAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005614.3-544s21c1
Sequence:CCGGCAAAGTTGATCACAGTAAATGCTCGAGCATTTACTGTGATCAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005614.3-786s21c1
Sequence:CCGGATGGAAAGGGTGATCAGTTATCTCGAGATAACTGATCACCCTTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.2-1100s1c1
Sequence:CCGGCCCTCCCTTCAGATTATGTTACTCGAGTAACATAATCTGAAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.2-514s1c1
Sequence:CCGGCCTACGATCCAACCATAGAAACTCGAGTTTCTATGGTTGGATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005614.2-598s1c1
Sequence:CCGGCCGGGCAAGATGAATATTCTACTCGAGTAGAATATTCATCTTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.2-750s1c1
Sequence:CCGGCCTATTATGTTGGTTGGGAATCTCGAGATTCCCAACCAACATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.x-624s1c1
Sequence:CCGGCCTCAGACATACTCCATAGATCTCGAGATCTATGGAGTATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.x-754s1c1
Sequence:CCGGTTATGTTGGTTGGGAATAAGACTCGAGTCTTATTCCCAACCAACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.x-573s1c1
Sequence:CCGGTATCATCTTCAACTTGTAGACCTCGAGGTCTACAAGTTGAAGATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005614
VALIDATED
RHEB MISSION shRNA shRNA Plasmid DNA
Ras homolog enriched in brain
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005614.3-486s21c1
Sequence:CCGGCAATTTGTTGAAGGCCAATTTCTCGAGAAATTGGCCTTCAACAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005614.3-544s21c1
Sequence:CCGGCAAAGTTGATCACAGTAAATGCTCGAGCATTTACTGTGATCAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005614.3-786s21c1
Sequence:CCGGATGGAAAGGGTGATCAGTTATCTCGAGATAACTGATCACCCTTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.2-1100s1c1
Sequence:CCGGCCCTCCCTTCAGATTATGTTACTCGAGTAACATAATCTGAAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.2-514s1c1
Sequence:CCGGCCTACGATCCAACCATAGAAACTCGAGTTTCTATGGTTGGATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005614.2-598s1c1
Sequence:CCGGCCGGGCAAGATGAATATTCTACTCGAGTAGAATATTCATCTTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.2-750s1c1
Sequence:CCGGCCTATTATGTTGGTTGGGAATCTCGAGATTCCCAACCAACATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.x-624s1c1
Sequence:CCGGCCTCAGACATACTCCATAGATCTCGAGATCTATGGAGTATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.x-754s1c1
Sequence:CCGGTTATGTTGGTTGGGAATAAGACTCGAGTCTTATTCCCAACCAACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.x-573s1c1
Sequence:CCGGTATCATCTTCAACTTGTAGACCTCGAGGTCTACAAGTTGAAGATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005614
VALIDATED
RHEB MISSION shRNA Lentiviral Transduction Particles
Ras homolog enriched in brain
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005614.3-486s21c1
Sequence:CCGGCAATTTGTTGAAGGCCAATTTCTCGAGAAATTGGCCTTCAACAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005614.3-544s21c1
Sequence:CCGGCAAAGTTGATCACAGTAAATGCTCGAGCATTTACTGTGATCAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005614.3-786s21c1
Sequence:CCGGATGGAAAGGGTGATCAGTTATCTCGAGATAACTGATCACCCTTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.2-1100s1c1
Sequence:CCGGCCCTCCCTTCAGATTATGTTACTCGAGTAACATAATCTGAAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.2-514s1c1
Sequence:CCGGCCTACGATCCAACCATAGAAACTCGAGTTTCTATGGTTGGATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005614.2-598s1c1
Sequence:CCGGCCGGGCAAGATGAATATTCTACTCGAGTAGAATATTCATCTTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.2-750s1c1
Sequence:CCGGCCTATTATGTTGGTTGGGAATCTCGAGATTCCCAACCAACATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.x-624s1c1
Sequence:CCGGCCTCAGACATACTCCATAGATCTCGAGATCTATGGAGTATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.x-754s1c1
Sequence:CCGGTTATGTTGGTTGGGAATAAGACTCGAGTCTTATTCCCAACCAACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005614.x-573s1c1
Sequence:CCGGTATCATCTTCAACTTGTAGACCTCGAGGTCTACAAGTTGAAGATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053075
VALIDATED
RHEB MISSION shRNA Bacterial Glycerol Stock
Ras homolog enriched in brain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-740s1c1
Sequence:CCGGCCCGTCATCCTTGAAGATAAACTCGAGTTTATCTTCAAGGATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-198s1c1
Sequence:CCGGCAGTTTGTTGAAGGCCAATTTCTCGAGAAATTGGCCTTCAACAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-339s1c1
Sequence:CCGGCAGACATACTCCATAGATATTCTCGAGAATATCTATGGAGTATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-643s1c1
Sequence:CCGGCAGCTTCACAAGGAAAGTCTTCTCGAGAAGACTTTCCTTGTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-455s1c1
Sequence:CCGGGCAGATACCTATTATGTTGGTCTCGAGACCAACATAATAGGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053075
VALIDATED
RHEB MISSION shRNA shRNA Plasmid DNA
Ras homolog enriched in brain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-740s1c1
Sequence:CCGGCCCGTCATCCTTGAAGATAAACTCGAGTTTATCTTCAAGGATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-198s1c1
Sequence:CCGGCAGTTTGTTGAAGGCCAATTTCTCGAGAAATTGGCCTTCAACAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-339s1c1
Sequence:CCGGCAGACATACTCCATAGATATTCTCGAGAATATCTATGGAGTATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-643s1c1
Sequence:CCGGCAGCTTCACAAGGAAAGTCTTCTCGAGAAGACTTTCCTTGTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-455s1c1
Sequence:CCGGGCAGATACCTATTATGTTGGTCTCGAGACCAACATAATAGGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053075
VALIDATED
RHEB MISSION shRNA Lentiviral Transduction Particles
Ras homolog enriched in brain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-740s1c1
Sequence:CCGGCCCGTCATCCTTGAAGATAAACTCGAGTTTATCTTCAAGGATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-198s1c1
Sequence:CCGGCAGTTTGTTGAAGGCCAATTTCTCGAGAAATTGGCCTTCAACAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-339s1c1
Sequence:CCGGCAGACATACTCCATAGATATTCTCGAGAATATCTATGGAGTATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-643s1c1
Sequence:CCGGCAGCTTCACAAGGAAAGTCTTCTCGAGAAGACTTTCCTTGTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053075.2-455s1c1
Sequence:CCGGGCAGATACCTATTATGTTGGTCTCGAGACCAACATAATAGGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks