EMAIL THIS PAGE TO A FRIEND

RHOT2

ras homolog family member T2

Synonyms: ARHT2 C16orf39 MIRO-2 MIRO2 RASL
Gene ID:
Human(89941) Summary: This gene encodes a member of the Rho family of GTPases. The encoded protein is localized to the outer mitochondrial membrane and plays a role in mitochondrial trafficking and fusion-fission dynamics. [provided by RefSeq, Nov 2011]
Mouse(214952) ras homolog gene family, member T2
Rat(287156) ras homolog family member T2
Zebrafish(557574) ras homolog gene family, member T2
chicken(427651) ras homolog family member T2
Horse(100066937) ras homolog family member T2
domestic cat(101093322) ras homolog family member T2
dog(479893) ras homolog family member T2
cow(352959) ras homolog family member T2
naked mole-rat(101699236) ras homolog family member T2
domestic guinea pig(100716407) ras homolog family member T2
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138769 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU047841 MISSION® esiRNA esiRNA targeting mouse Rhot2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138769 Rosetta Predictions human pricing
NM_181823 Rosetta Predictions rat pricing
NM_145999 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127558 predicted 1790
2 SASI_Hs01_00127559 predicted 1525
3 SASI_Hs01_00127560 predicted 1673
4 SASI_Hs01_00127561 predicted 1551
5 SASI_Hs01_00127562 predicted 1252
6 SASI_Hs01_00127563 predicted 1439
7 SASI_Hs01_00127565 predicted 2020
8 SASI_Hs01_00127566 predicted 975
9 SASI_Hs02_00363885 predicted 964
10 SASI_Hs01_00127567 predicted 1527
11 SASI_Hs01_00127564 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093203 predicted 1714
2 SASI_Rn01_00093204 predicted 2192
3 SASI_Rn01_00093205 predicted 520
4 SASI_Rn01_00093206 predicted 1889
5 SASI_Rn01_00093207 predicted 1164
6 SASI_Rn01_00093208 predicted 2068
7 SASI_Rn01_00093209 predicted 1548
8 SASI_Rn01_00093210 predicted 2195
9 SASI_Rn01_00093211 predicted 2026
10 SASI_Rn01_00093212 predicted 1904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173196 predicted 1944
2 SASI_Mm01_00173197 predicted 1927
3 SASI_Mm01_00173199 predicted 1815
4 SASI_Mm02_00341534 predicted 2231
5 SASI_Mm01_00173200 predicted 1857
6 SASI_Mm01_00173201 predicted 1598
7 SASI_Mm01_00173202 predicted 1988
8 SASI_Mm01_00173203 predicted 1933
9 SASI_Mm02_00341535 predicted 2258
10 SASI_Mm01_00173204 predicted 1898
11 SASI_Mm01_00173198 predicted 1879
12 SASI_Mm01_00173205 predicted 1359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145999
VALIDATED
RHOT2 MISSION shRNA Bacterial Glycerol Stock
ras homolog family member T2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145999.2-1819s1c1
Sequence:CCGGCCTGATTCTGTGTGAAGTGAACTCGAGTTCACTTCACACAGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145999.2-1935s1c1
Sequence:CCGGCTACCATATACAAGCGTTATTCTCGAGAATAACGCTTGTATATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145999.2-1934s1c1
Sequence:CCGGGCTACCATATACAAGCGTTATCTCGAGATAACGCTTGTATATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145999.2-568s1c1
Sequence:CCGGGCCCACTCATATCGTGGATTACTCGAGTAATCCACGATATGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-1320s21c1
Sequence:CCGGACCATCGTGGCTACCAGTTTGCTCGAGCAAACTGGTAGCCACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145999.2-569s21c1
Sequence:CCGGCCCACTCATATCGTGGATTACCTCGAGGTAATCCACGATATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-879s21c1
Sequence:CCGGTCTCAGAGCTGTTCTACTATGCTCGAGCATAGTAGAACAGCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-2364s21c1
Sequence:CCGGTTCGGCCTGTTGGAGTAATATCTCGAGATATTACTCCAACAGGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-1936s21c1
Sequence:CCGGTACCATATACAAGCGTTATTACTCGAGTAATAACGCTTGTATATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145999
VALIDATED
RHOT2 MISSION shRNA shRNA Plasmid DNA
ras homolog family member T2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145999.2-1819s1c1
Sequence:CCGGCCTGATTCTGTGTGAAGTGAACTCGAGTTCACTTCACACAGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145999.2-1935s1c1
Sequence:CCGGCTACCATATACAAGCGTTATTCTCGAGAATAACGCTTGTATATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145999.2-1934s1c1
Sequence:CCGGGCTACCATATACAAGCGTTATCTCGAGATAACGCTTGTATATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145999.2-568s1c1
Sequence:CCGGGCCCACTCATATCGTGGATTACTCGAGTAATCCACGATATGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-1320s21c1
Sequence:CCGGACCATCGTGGCTACCAGTTTGCTCGAGCAAACTGGTAGCCACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145999.2-569s21c1
Sequence:CCGGCCCACTCATATCGTGGATTACCTCGAGGTAATCCACGATATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-879s21c1
Sequence:CCGGTCTCAGAGCTGTTCTACTATGCTCGAGCATAGTAGAACAGCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-2364s21c1
Sequence:CCGGTTCGGCCTGTTGGAGTAATATCTCGAGATATTACTCCAACAGGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-1936s21c1
Sequence:CCGGTACCATATACAAGCGTTATTACTCGAGTAATAACGCTTGTATATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145999
VALIDATED
RHOT2 MISSION shRNA Lentiviral Transduction Particles
ras homolog family member T2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145999.2-1819s1c1
Sequence:CCGGCCTGATTCTGTGTGAAGTGAACTCGAGTTCACTTCACACAGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145999.2-1935s1c1
Sequence:CCGGCTACCATATACAAGCGTTATTCTCGAGAATAACGCTTGTATATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145999.2-1934s1c1
Sequence:CCGGGCTACCATATACAAGCGTTATCTCGAGATAACGCTTGTATATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145999.2-568s1c1
Sequence:CCGGGCCCACTCATATCGTGGATTACTCGAGTAATCCACGATATGAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-1320s21c1
Sequence:CCGGACCATCGTGGCTACCAGTTTGCTCGAGCAAACTGGTAGCCACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145999.2-569s21c1
Sequence:CCGGCCCACTCATATCGTGGATTACCTCGAGGTAATCCACGATATGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-879s21c1
Sequence:CCGGTCTCAGAGCTGTTCTACTATGCTCGAGCATAGTAGAACAGCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-2364s21c1
Sequence:CCGGTTCGGCCTGTTGGAGTAATATCTCGAGATATTACTCCAACAGGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145999.2-1936s21c1
Sequence:CCGGTACCATATACAAGCGTTATTACTCGAGTAATAACGCTTGTATATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138769
VALIDATED
RHOT2 MISSION shRNA Bacterial Glycerol Stock
ras homolog family member T2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000072919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-1585s1c1
Sequence:CCGGCGTCTACAAGCACCATTACATCTCGAGATGTAATGGTGCTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-227s1c1
Sequence:CCGGCACATCGTGGACTACTCAGAACTCGAGTTCTGAGTAGTCCACGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-1584s1c1
Sequence:CCGGGCGTCTACAAGCACCATTACACTCGAGTGTAATGGTGCTTGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-2253s1c1
Sequence:CCGGCCCAGAATTCTCAGGGCTCTACTCGAGTAGAGCCCTGAGAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138769
VALIDATED
RHOT2 MISSION shRNA shRNA Plasmid DNA
ras homolog family member T2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000072919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-1585s1c1
Sequence:CCGGCGTCTACAAGCACCATTACATCTCGAGATGTAATGGTGCTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-227s1c1
Sequence:CCGGCACATCGTGGACTACTCAGAACTCGAGTTCTGAGTAGTCCACGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-1584s1c1
Sequence:CCGGGCGTCTACAAGCACCATTACACTCGAGTGTAATGGTGCTTGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-2253s1c1
Sequence:CCGGCCCAGAATTCTCAGGGCTCTACTCGAGTAGAGCCCTGAGAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138769
VALIDATED
RHOT2 MISSION shRNA Lentiviral Transduction Particles
ras homolog family member T2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000072919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-1585s1c1
Sequence:CCGGCGTCTACAAGCACCATTACATCTCGAGATGTAATGGTGCTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-227s1c1
Sequence:CCGGCACATCGTGGACTACTCAGAACTCGAGTTCTGAGTAGTCCACGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-1584s1c1
Sequence:CCGGGCGTCTACAAGCACCATTACACTCGAGTGTAATGGTGCTTGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138769.1-2253s1c1
Sequence:CCGGCCCAGAATTCTCAGGGCTCTACTCGAGTAGAGCCCTGAGAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks