EMAIL THIS PAGE TO A FRIEND

RHPN1

rhophilin, Rho GTPase binding protein 1

Synonyms: ODF5 RHOPHILIN RHPN
UniProtKB ID: Q8TCX5, Q8TAV1, Q96PV9
Gene ID:
Mouse(14787) rhophilin, Rho GTPase binding protein 1
Rat(300030) rhophilin, Rho GTPase binding protein 1
Zebrafish(100537370) rhophilin, Rho GTPase binding protein 1
domestic cat(101088983) rhophilin, Rho GTPase binding protein 1
dog(482076) rhophilin, Rho GTPase binding protein 1
chicken(420299) rhophilin, Rho GTPase binding protein 1
cow(618397) rhophilin, Rho GTPase binding protein 1
sheep(101114282) rhophilin, Rho GTPase binding protein 1
domestic guinea pig(100729147) rhophilin, Rho GTPase binding protein 1
naked mole-rat(101725723) rhophilin, Rho GTPase binding protein 1
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052924 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052924 Rosetta Predictions human pricing
XM_001069922 Rosetta Predictions rat pricing
XM_216954 Rosetta Predictions rat pricing
NM_008164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361679 predicted 2361
2 SASI_Hs02_00361680 predicted 2029
3 SASI_Hs02_00361681 predicted 2414
4 SASI_Hs02_00361682 predicted 1722
5 SASI_Hs01_00213781 predicted 631
6 SASI_Hs01_00213782 predicted 1687
7 SASI_Hs02_00361683 predicted 2214
8 SASI_Hs02_00361684 predicted 541
9 SASI_Hs01_00213783 predicted 1083
10 SASI_Hs01_00213784 predicted 1535
11 SASI_Hs01_00213778 predicted 387
12 SASI_Hs01_00213779 predicted 1718
13 SASI_Hs01_00213780 predicted 1735
14 SASI_Hs01_00213785 predicted 625
15 SASI_Hs01_00213786 predicted 722
16 SASI_Hs01_00213787 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329821 predicted 1420
2 SASI_Rn02_00329822 predicted 764
3 SASI_Rn02_00329823 predicted 1761
4 SASI_Rn02_00329824 predicted 1074
5 SASI_Rn02_00329825 predicted 694
6 SASI_Rn02_00329826 predicted 307
7 SASI_Rn02_00329827 predicted 1148
8 SASI_Rn02_00329828 predicted 752
9 SASI_Rn02_00329829 predicted 1140
10 SASI_Rn02_00329830 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376937 predicted 758
2 SASI_Rn02_00376938 predicted 1235
3 SASI_Rn02_00376939 predicted 1070
4 SASI_Rn02_00376940 predicted 695
5 SASI_Rn02_00376941 predicted 309
6 SASI_Rn02_00376942 predicted 1149
7 SASI_Rn02_00376943 predicted 746
8 SASI_Rn02_00376944 predicted 1138
9 SASI_Rn02_00376945 predicted 621
10 SASI_Rn02_00376946 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192576 predicted 228
2 SASI_Mm01_00192577 predicted 447
3 SASI_Mm01_00192579 predicted 202
4 SASI_Mm01_00192580 predicted 424
5 SASI_Mm01_00192581 predicted 645
6 SASI_Mm01_00192582 predicted 326
7 SASI_Mm01_00192583 predicted 1596
8 SASI_Mm02_00313275 predicted 295
9 SASI_Mm02_00313276 predicted 328
10 SASI_Mm01_00192585 predicted 772
11 SASI_Mm01_00192578 predicted 1058
12 SASI_Mm01_00192584 predicted 410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008164
RHPN1 MISSION shRNA Bacterial Glycerol Stock
rhophilin, Rho GTPase binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-1028s21c1
Sequence:CCGGGACATCTGTCCAGATCAACTGCTCGAGCAGTTGATCTGGACAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-1724s21c1
Sequence:CCGGGACTACATCGTGTCCGTGAACCTCGAGGTTCACGGACACGATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-313s21c1
Sequence:CCGGCAACACCTGGGTCCGAGAAACCTCGAGGTTTCTCGGACCCAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-804s21c1
Sequence:CCGGAGATTGGAGCACGGCAGGATTCTCGAGAATCCTGCCGTGCTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-327s1c1
Sequence:CCGGCGAAGGGATTACTATTCCCATCTCGAGATGGGAATAGTAATCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-530s1c1
Sequence:CCGGCCTACTATAGCCAGCTCTGTTCTCGAGAACAGAGCTGGCTATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-76s1c1
Sequence:CCGGCGCAAGGGCTATGGCTCCTTTCTCGAGAAAGGAGCCATAGCCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-967s1c1
Sequence:CCGGGTGGCAACTGAATATGGGCTTCTCGAGAAGCCCATATTCAGTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-657s1c1
Sequence:CCGGGAAGGGCAGTGTACTGTTTAACTCGAGTTAAACAGTACACTGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008164
RHPN1 MISSION shRNA shRNA Plasmid DNA
rhophilin, Rho GTPase binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-1028s21c1
Sequence:CCGGGACATCTGTCCAGATCAACTGCTCGAGCAGTTGATCTGGACAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-1724s21c1
Sequence:CCGGGACTACATCGTGTCCGTGAACCTCGAGGTTCACGGACACGATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-313s21c1
Sequence:CCGGCAACACCTGGGTCCGAGAAACCTCGAGGTTTCTCGGACCCAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-804s21c1
Sequence:CCGGAGATTGGAGCACGGCAGGATTCTCGAGAATCCTGCCGTGCTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-327s1c1
Sequence:CCGGCGAAGGGATTACTATTCCCATCTCGAGATGGGAATAGTAATCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-530s1c1
Sequence:CCGGCCTACTATAGCCAGCTCTGTTCTCGAGAACAGAGCTGGCTATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-76s1c1
Sequence:CCGGCGCAAGGGCTATGGCTCCTTTCTCGAGAAAGGAGCCATAGCCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-967s1c1
Sequence:CCGGGTGGCAACTGAATATGGGCTTCTCGAGAAGCCCATATTCAGTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-657s1c1
Sequence:CCGGGAAGGGCAGTGTACTGTTTAACTCGAGTTAAACAGTACACTGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008164
RHPN1 MISSION shRNA Lentiviral Transduction Particles
rhophilin, Rho GTPase binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-1028s21c1
Sequence:CCGGGACATCTGTCCAGATCAACTGCTCGAGCAGTTGATCTGGACAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-1724s21c1
Sequence:CCGGGACTACATCGTGTCCGTGAACCTCGAGGTTCACGGACACGATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-313s21c1
Sequence:CCGGCAACACCTGGGTCCGAGAAACCTCGAGGTTTCTCGGACCCAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008164.2-804s21c1
Sequence:CCGGAGATTGGAGCACGGCAGGATTCTCGAGAATCCTGCCGTGCTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-327s1c1
Sequence:CCGGCGAAGGGATTACTATTCCCATCTCGAGATGGGAATAGTAATCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-530s1c1
Sequence:CCGGCCTACTATAGCCAGCTCTGTTCTCGAGAACAGAGCTGGCTATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-76s1c1
Sequence:CCGGCGCAAGGGCTATGGCTCCTTTCTCGAGAAAGGAGCCATAGCCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-967s1c1
Sequence:CCGGGTGGCAACTGAATATGGGCTTCTCGAGAAGCCCATATTCAGTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008164.1-657s1c1
Sequence:CCGGGAAGGGCAGTGTACTGTTTAACTCGAGTTAAACAGTACACTGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052924
VALIDATED
RHPN1 MISSION shRNA Bacterial Glycerol Stock
rhophilin, Rho GTPase binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-714s21c1
Sequence:CCGGACTGGTACGACTCGCTTACTGCTCGAGCAGTAAGCGAGTCGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-629s21c1
Sequence:CCGGGAGCTGCTCACAGCCTATTACCTCGAGGTAATAGGCTGTGAGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052924.2-2268s21c1
Sequence:CCGGGGCACCTGCCTGCCCATTAAACTCGAGTTTAATGGGCAGGCAGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-250s21c1
Sequence:CCGGGATTCACCAGCAGATTGACAACTCGAGTTGTCAATCTGCTGGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-1791s21c1
Sequence:CCGGACTACATTGTGTCAGTGAATGCTCGAGCATTCACTGACACAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-1732s1c1
Sequence:CCGGGACTACATTGTGTCAGTGAATCTCGAGATTCACTGACACAATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-1572s1c1
Sequence:CCGGGTCTGTGTTCTCAGCCAAGAACTCGAGTTCTTGGCTGAGAACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-1111s1c1
Sequence:CCGGCCACCACACTTGCCCATGGTACTCGAGTACCATGGGCAAGTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_052924.1-414s1c1
Sequence:CCGGCGCCTCCTACGAGGCAGAAATCTCGAGATTTCTGCCTCGTAGGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-498s1c1
Sequence:CCGGGCTGCTCACAGCCTATTACAACTCGAGTTGTAATAGGCTGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052924
VALIDATED
RHPN1 MISSION shRNA shRNA Plasmid DNA
rhophilin, Rho GTPase binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-714s21c1
Sequence:CCGGACTGGTACGACTCGCTTACTGCTCGAGCAGTAAGCGAGTCGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-629s21c1
Sequence:CCGGGAGCTGCTCACAGCCTATTACCTCGAGGTAATAGGCTGTGAGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052924.2-2268s21c1
Sequence:CCGGGGCACCTGCCTGCCCATTAAACTCGAGTTTAATGGGCAGGCAGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-250s21c1
Sequence:CCGGGATTCACCAGCAGATTGACAACTCGAGTTGTCAATCTGCTGGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-1791s21c1
Sequence:CCGGACTACATTGTGTCAGTGAATGCTCGAGCATTCACTGACACAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-1732s1c1
Sequence:CCGGGACTACATTGTGTCAGTGAATCTCGAGATTCACTGACACAATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-1572s1c1
Sequence:CCGGGTCTGTGTTCTCAGCCAAGAACTCGAGTTCTTGGCTGAGAACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-1111s1c1
Sequence:CCGGCCACCACACTTGCCCATGGTACTCGAGTACCATGGGCAAGTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_052924.1-414s1c1
Sequence:CCGGCGCCTCCTACGAGGCAGAAATCTCGAGATTTCTGCCTCGTAGGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-498s1c1
Sequence:CCGGGCTGCTCACAGCCTATTACAACTCGAGTTGTAATAGGCTGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052924
VALIDATED
RHPN1 MISSION shRNA Lentiviral Transduction Particles
rhophilin, Rho GTPase binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-714s21c1
Sequence:CCGGACTGGTACGACTCGCTTACTGCTCGAGCAGTAAGCGAGTCGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-629s21c1
Sequence:CCGGGAGCTGCTCACAGCCTATTACCTCGAGGTAATAGGCTGTGAGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052924.2-2268s21c1
Sequence:CCGGGGCACCTGCCTGCCCATTAAACTCGAGTTTAATGGGCAGGCAGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-250s21c1
Sequence:CCGGGATTCACCAGCAGATTGACAACTCGAGTTGTCAATCTGCTGGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052924.2-1791s21c1
Sequence:CCGGACTACATTGTGTCAGTGAATGCTCGAGCATTCACTGACACAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-1732s1c1
Sequence:CCGGGACTACATTGTGTCAGTGAATCTCGAGATTCACTGACACAATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-1572s1c1
Sequence:CCGGGTCTGTGTTCTCAGCCAAGAACTCGAGTTCTTGGCTGAGAACACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-1111s1c1
Sequence:CCGGCCACCACACTTGCCCATGGTACTCGAGTACCATGGGCAAGTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_052924.1-414s1c1
Sequence:CCGGCGCCTCCTACGAGGCAGAAATCTCGAGATTTCTGCCTCGTAGGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052924.1-498s1c1
Sequence:CCGGGCTGCTCACAGCCTATTACAACTCGAGTTGTAATAGGCTGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks