EMAIL THIS PAGE TO A FRIEND

RIC8A

RIC8 guanine nucleotide exchange factor A

Synonyms: RIC8
Gene ID:
Rat(293614) resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
cow(521037) resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
sheep(101106895) resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
naked mole-rat(101699116) resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
domestic guinea pig(100731415) resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
fruit fly(31874) CG15797 gene product from transcript CG15797-RA
chicken(422987) resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
dog(475932) resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
domestic cat(101080576) resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
Horse(100051024) resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
Zebrafish(449546) resistance to inhibitors of cholinesterase 8 homolog A
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021932 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033251 MISSION® esiRNA esiRNA human RIC8A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021932 Rosetta Predictions human pricing
NM_001100520 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234061 predicted 1461
2 SASI_Hs01_00234062 predicted 1229
3 SASI_Hs01_00234063 predicted 2128
4 SASI_Hs01_00234064 predicted 2163
5 SASI_Hs01_00234065 predicted 647
6 SASI_Hs01_00234066 predicted 2136
7 SASI_Hs01_00234067 predicted 1779
8 SASI_Hs01_00234068 predicted 1741
9 SASI_Hs01_00234070 predicted 654
10 SASI_Hs02_00355224 predicted 1243
11 SASI_Hs01_00234069 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209944 predicted 426
2 SASI_Rn02_00209945 predicted 579
3 SASI_Rn02_00209946 predicted 1125
4 SASI_Rn02_00209947 predicted 1565
5 SASI_Rn02_00209948 predicted 1580
6 SASI_Rn02_00209949 predicted 299
7 SASI_Rn02_00209950 predicted 1347
8 SASI_Rn02_00209951 predicted 1116
9 SASI_Rn02_00209952 predicted 926
10 SASI_Rn02_00209953 predicted 1765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021932
VALIDATED
RIC8A MISSION shRNA Bacterial Glycerol Stock
RIC8 guanine nucleotide exchange factor A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-2387s21c1
Sequence:CCGGGAACTTTCCATACGAGTATATCTCGAGATATACTCGTATGGAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-647s21c1
Sequence:CCGGTCCGCAGACATGGATGTTGTACTCGAGTACAACATCCATGTCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-1224s21c1
Sequence:CCGGCGGAGTTCATGGGAGTGAATACTCGAGTATTCACTCCCATGAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-1673s21c1
Sequence:CCGGGATGAGTACAAGGAAGCCAAACTCGAGTTTGGCTTCCTTGTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-380s21c1
Sequence:CCGGATGGAAGCTCTGCGGTCATACCTCGAGGTATGACCGCAGAGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-1223s1c1
Sequence:CCGGACGGAGTTCATGGGAGTGAATCTCGAGATTCACTCCCATGAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-2422s1c1
Sequence:CCGGCCAAGGTATGTATGCTCTGTTCTCGAGAACAGAGCATACATACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-647s1c1
Sequence:CCGGTCCGCAGACATGGATGTTGTACTCGAGTACAACATCCATGTCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-1224s1c1
Sequence:CCGGCGGAGTTCATGGGAGTGAATACTCGAGTATTCACTCCCATGAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-1673s1c1
Sequence:CCGGGATGAGTACAAGGAAGCCAAACTCGAGTTTGGCTTCCTTGTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021932
VALIDATED
RIC8A MISSION shRNA shRNA Plasmid DNA
RIC8 guanine nucleotide exchange factor A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-2387s21c1
Sequence:CCGGGAACTTTCCATACGAGTATATCTCGAGATATACTCGTATGGAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-647s21c1
Sequence:CCGGTCCGCAGACATGGATGTTGTACTCGAGTACAACATCCATGTCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-1224s21c1
Sequence:CCGGCGGAGTTCATGGGAGTGAATACTCGAGTATTCACTCCCATGAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-1673s21c1
Sequence:CCGGGATGAGTACAAGGAAGCCAAACTCGAGTTTGGCTTCCTTGTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-380s21c1
Sequence:CCGGATGGAAGCTCTGCGGTCATACCTCGAGGTATGACCGCAGAGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-1223s1c1
Sequence:CCGGACGGAGTTCATGGGAGTGAATCTCGAGATTCACTCCCATGAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-2422s1c1
Sequence:CCGGCCAAGGTATGTATGCTCTGTTCTCGAGAACAGAGCATACATACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-647s1c1
Sequence:CCGGTCCGCAGACATGGATGTTGTACTCGAGTACAACATCCATGTCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-1224s1c1
Sequence:CCGGCGGAGTTCATGGGAGTGAATACTCGAGTATTCACTCCCATGAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-1673s1c1
Sequence:CCGGGATGAGTACAAGGAAGCCAAACTCGAGTTTGGCTTCCTTGTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021932
VALIDATED
RIC8A MISSION shRNA Lentiviral Transduction Particles
RIC8 guanine nucleotide exchange factor A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-2387s21c1
Sequence:CCGGGAACTTTCCATACGAGTATATCTCGAGATATACTCGTATGGAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-647s21c1
Sequence:CCGGTCCGCAGACATGGATGTTGTACTCGAGTACAACATCCATGTCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-1224s21c1
Sequence:CCGGCGGAGTTCATGGGAGTGAATACTCGAGTATTCACTCCCATGAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-1673s21c1
Sequence:CCGGGATGAGTACAAGGAAGCCAAACTCGAGTTTGGCTTCCTTGTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021932.4-380s21c1
Sequence:CCGGATGGAAGCTCTGCGGTCATACCTCGAGGTATGACCGCAGAGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-1223s1c1
Sequence:CCGGACGGAGTTCATGGGAGTGAATCTCGAGATTCACTCCCATGAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-2422s1c1
Sequence:CCGGCCAAGGTATGTATGCTCTGTTCTCGAGAACAGAGCATACATACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-647s1c1
Sequence:CCGGTCCGCAGACATGGATGTTGTACTCGAGTACAACATCCATGTCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-1224s1c1
Sequence:CCGGCGGAGTTCATGGGAGTGAATACTCGAGTATTCACTCCCATGAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_021932.4-1673s1c1
Sequence:CCGGGATGAGTACAAGGAAGCCAAACTCGAGTTTGGCTTCCTTGTACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks