EMAIL THIS PAGE TO A FRIEND

RIMBP3B

RIMS binding protein 3B

Synonyms: RIM-BP3.2 RIM-BP3.B RIMBP3.2
UniProtKB ID: A6NNM3
Gene ID:
cow(528977) RIMS binding protein 3B
domestic guinea pig(100713785) RIMS binding protein 3B
naked mole-rat(101703106) RIMS binding protein 3B
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128635 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109801 MISSION® esiRNA esiRNA human RIMBP3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_036936 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_036936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289863 predicted 3720
2 SASI_Hs01_00289864 predicted 4117
3 SASI_Hs01_00289865 predicted 3489
4 SASI_Hs01_00289866 predicted 3377
5 SASI_Hs01_00289867 predicted 3073
6 SASI_Hs01_00289868 predicted 3725
7 SASI_Hs01_00289869 predicted 2141
8 SASI_Hs01_00289870 predicted 2171
9 SASI_Hs01_00289871 predicted 1344
10 SASI_Hs01_00289872 predicted 2067
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128635
RIMBP3B MISSION shRNA Bacterial Glycerol Stock
RIMS binding protein 3B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-1481s21c1
Sequence:CCGGTGGAGCTGTGCCAAGTCTTTGCTCGAGCAAAGACTTGGCACAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128635.1-5114s21c1
Sequence:CCGGCCCTCCTCACCACCATAAGTACTCGAGTACTTATGGTGGTGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-4218s21c1
Sequence:CCGGGTATGCATCTGACTTCCATAACTCGAGTTATGGAAGTCAGATGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-3830s21c1
Sequence:CCGGAGTTCCTAGAAGCATTCTTTGCTCGAGCAAAGAATGCTTCTAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-1347s21c1
Sequence:CCGGGGTGAAGCGGCTCAAGGTAAACTCGAGTTTACCTTGAGCCGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128635
RIMBP3B MISSION shRNA shRNA Plasmid DNA
RIMS binding protein 3B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-1481s21c1
Sequence:CCGGTGGAGCTGTGCCAAGTCTTTGCTCGAGCAAAGACTTGGCACAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128635.1-5114s21c1
Sequence:CCGGCCCTCCTCACCACCATAAGTACTCGAGTACTTATGGTGGTGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-4218s21c1
Sequence:CCGGGTATGCATCTGACTTCCATAACTCGAGTTATGGAAGTCAGATGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-3830s21c1
Sequence:CCGGAGTTCCTAGAAGCATTCTTTGCTCGAGCAAAGAATGCTTCTAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-1347s21c1
Sequence:CCGGGGTGAAGCGGCTCAAGGTAAACTCGAGTTTACCTTGAGCCGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128635
RIMBP3B MISSION shRNA Lentiviral Transduction Particles
RIMS binding protein 3B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-1481s21c1
Sequence:CCGGTGGAGCTGTGCCAAGTCTTTGCTCGAGCAAAGACTTGGCACAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128635.1-5114s21c1
Sequence:CCGGCCCTCCTCACCACCATAAGTACTCGAGTACTTATGGTGGTGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-4218s21c1
Sequence:CCGGGTATGCATCTGACTTCCATAACTCGAGTTATGGAAGTCAGATGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-3830s21c1
Sequence:CCGGAGTTCCTAGAAGCATTCTTTGCTCGAGCAAAGAATGCTTCTAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128635.1-1347s21c1
Sequence:CCGGGGTGAAGCGGCTCAAGGTAAACTCGAGTTTACCTTGAGCCGCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks