EMAIL THIS PAGE TO A FRIEND

RNASE2

ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)

Synonyms: EDN RNS2
UniProtKB ID: P10153, Q52M39, Q9H2B7, Q9UCG7
Gene ID:
Rat(474169) ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)
sheep(101112062) ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)
fruit fly(5656972) Ribonuclease 2
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002934 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108261 MISSION® esiRNA esiRNA human RNASE2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002934 Rosetta Predictions human pricing
NM_001007015 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152773 predicted 371
2 SASI_Hs01_00152774 predicted 383
3 SASI_Hs01_00152775 predicted 327
4 SASI_Hs01_00152776 predicted 214
5 SASI_Hs01_00152777 predicted 411
6 SASI_Hs01_00152778 predicted 319
7 SASI_Hs01_00152779 predicted 403
8 SASI_Hs01_00152780 predicted 374
9 SASI_Hs01_00152781 predicted 207
10 SASI_Hs02_00334766 predicted 401
11 SASI_Hs01_00152782 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198609 predicted 200
2 SASI_Rn01_00033414 predicted 339
3 SASI_Rn01_00033415 predicted 417
4 SASI_Rn01_00033416 predicted 341
5 SASI_Rn01_00033417 predicted 313
6 SASI_Rn01_00033418 predicted 410
7 SASI_Rn01_00033419 predicted 323
8 SASI_Rn01_00033420 predicted 318
9 SASI_Rn01_00033421 predicted 206
10 SASI_Rn01_00033422 predicted 224
11 SASI_Rn01_00033423 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002934
RNASE2 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-169s1c1
Sequence:CCGGCCTGGGCTCAATGGTTTGAAACTCGAGTTTCAAACCATTGAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-510s1c1
Sequence:CCGGCCTCCACAGTATCCGGTGGTTCTCGAGAACCACCGGATACTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-228s1c1
Sequence:CCGGGCAATGCAGGTCATTAACAATCTCGAGATTGTTAATGACCTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-409s1c1
Sequence:CCGGCAACTCCAAGTCCACAGAATACTCGAGTATTCTGTGGACTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-223s1c1
Sequence:CCGGCCAATGCAATGCAGGTCATTACTCGAGTAATGACCTGCATTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002934.2-329s21c1
Sequence:CCGGTATGACCTGTCCTAGTAACAACTCGAGTTGTTACTAGGACAGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002934.2-375s21c1
Sequence:CCGGGGAAGCCAGGTGCCTTTAATCCTCGAGGATTAAAGGCACCTGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002934.2-192s21c1
Sequence:CCGGCAGCACATCAATATGACCTCCCTCGAGGGAGGTCATATTGATGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002934
RNASE2 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-169s1c1
Sequence:CCGGCCTGGGCTCAATGGTTTGAAACTCGAGTTTCAAACCATTGAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-510s1c1
Sequence:CCGGCCTCCACAGTATCCGGTGGTTCTCGAGAACCACCGGATACTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-228s1c1
Sequence:CCGGGCAATGCAGGTCATTAACAATCTCGAGATTGTTAATGACCTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-409s1c1
Sequence:CCGGCAACTCCAAGTCCACAGAATACTCGAGTATTCTGTGGACTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-223s1c1
Sequence:CCGGCCAATGCAATGCAGGTCATTACTCGAGTAATGACCTGCATTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002934.2-329s21c1
Sequence:CCGGTATGACCTGTCCTAGTAACAACTCGAGTTGTTACTAGGACAGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002934.2-375s21c1
Sequence:CCGGGGAAGCCAGGTGCCTTTAATCCTCGAGGATTAAAGGCACCTGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002934.2-192s21c1
Sequence:CCGGCAGCACATCAATATGACCTCCCTCGAGGGAGGTCATATTGATGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002934
RNASE2 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-169s1c1
Sequence:CCGGCCTGGGCTCAATGGTTTGAAACTCGAGTTTCAAACCATTGAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-510s1c1
Sequence:CCGGCCTCCACAGTATCCGGTGGTTCTCGAGAACCACCGGATACTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-228s1c1
Sequence:CCGGGCAATGCAGGTCATTAACAATCTCGAGATTGTTAATGACCTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-409s1c1
Sequence:CCGGCAACTCCAAGTCCACAGAATACTCGAGTATTCTGTGGACTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002934.2-223s1c1
Sequence:CCGGCCAATGCAATGCAGGTCATTACTCGAGTAATGACCTGCATTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002934.2-329s21c1
Sequence:CCGGTATGACCTGTCCTAGTAACAACTCGAGTTGTTACTAGGACAGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002934.2-375s21c1
Sequence:CCGGGGAAGCCAGGTGCCTTTAATCCTCGAGGATTAAAGGCACCTGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002934.2-192s21c1
Sequence:CCGGCAGCACATCAATATGACCTCCCTCGAGGGAGGTCATATTGATGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks