EMAIL THIS PAGE TO A FRIEND

RNASE9

ribonuclease, RNase A family, 9 (non-active)

Synonyms: HEL128 h461
UniProtKB ID: P60153, A2RQR8, A8QJS1, Q5GAN7, Q6KG53
Gene ID:
Mouse(328401) ribonuclease, RNase A family, 9 (non-active)
Rat(364301) ribonuclease, RNase A family, 9 (non-active)
cow(101905497) ribonuclease, RNase A family, 9 (non-active)
naked mole-rat(101713438) ribonuclease, RNase A family, 9 (non-active)
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001673 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001673 Rosetta Predictions human pricing
NM_001110356 Rosetta Predictions human pricing
NM_001110357 Rosetta Predictions human pricing
NM_001110358 Rosetta Predictions human pricing
NM_001110359 Rosetta Predictions human pricing
NM_001110360 Rosetta Predictions human pricing
NM_001110361 Rosetta Predictions human pricing
NM_001008561 Rosetta Predictions rat pricing
XM_579198 Rosetta Predictions rat pricing
NM_183032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303870 predicted 592
2 SASI_Hs01_00165340 predicted 458
3 SASI_Hs02_00303871 predicted 534
4 SASI_Hs02_00303872 predicted 523
5 SASI_Hs01_00165341 predicted 291
6 SASI_Hs02_00303873 predicted 556
7 SASI_Hs02_00303874 predicted 471
8 SASI_Hs02_00303875 predicted 470
9 SASI_Hs02_00303876 predicted 731
10 SASI_Hs02_00303877 predicted 514
11 SASI_Hs01_00165338 predicted 298
12 SASI_Hs01_00165339 predicted 291
13 SASI_Hs01_00165342 predicted 225
14 SASI_Hs01_00165343 predicted 392
15 SASI_Hs01_00165344 predicted 399
16 SASI_Hs01_00165345 predicted 227
17 SASI_Hs01_00165346 predicted 373
18 SASI_Hs01_00165347 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324925 predicted 649
2 SASI_Hs02_00324926 predicted 515
3 SASI_Hs02_00324927 predicted 584
4 SASI_Hs02_00324928 predicted 572
5 SASI_Hs02_00324929 predicted 348
6 SASI_Hs02_00324930 predicted 605
7 SASI_Hs02_00324931 predicted 525
8 SASI_Hs02_00324932 predicted 524
9 SASI_Hs02_00324933 predicted 781
10 SASI_Hs02_00324934 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324935 predicted 627
2 SASI_Hs02_00324936 predicted 496
3 SASI_Hs02_00324937 predicted 568
4 SASI_Hs02_00324938 predicted 558
5 SASI_Hs02_00324939 predicted 331
6 SASI_Hs02_00324940 predicted 587
7 SASI_Hs02_00324941 predicted 513
8 SASI_Hs02_00324942 predicted 509
9 SASI_Hs02_00324943 predicted 763
10 SASI_Hs02_00324944 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324945 predicted 688
2 SASI_Hs02_00324946 predicted 548
3 SASI_Hs02_00324947 predicted 626
4 SASI_Hs02_00324948 predicted 607
5 SASI_Hs02_00324949 predicted 385
6 SASI_Hs02_00324950 predicted 648
7 SASI_Hs02_00324951 predicted 564
8 SASI_Hs02_00324952 predicted 562
9 SASI_Hs02_00324953 predicted 819
10 SASI_Hs02_00324954 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324955 predicted 792
2 SASI_Hs02_00324956 predicted 663
3 SASI_Hs02_00324957 predicted 735
4 SASI_Hs02_00324958 predicted 721
5 SASI_Hs02_00324959 predicted 496
6 SASI_Hs02_00324960 predicted 757
7 SASI_Hs02_00324961 predicted 672
8 SASI_Hs02_00324962 predicted 666
9 SASI_Hs02_00324963 predicted 920
10 SASI_Hs02_00324964 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324965 predicted 763
2 SASI_Hs02_00324966 predicted 629
3 SASI_Hs02_00324967 predicted 696
4 SASI_Hs02_00324968 predicted 686
5 SASI_Hs02_00324969 predicted 455
6 SASI_Hs02_00324970 predicted 715
7 SASI_Hs02_00324971 predicted 640
8 SASI_Hs02_00324972 predicted 632
9 SASI_Hs02_00324973 predicted 889
10 SASI_Hs02_00324974 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324975 predicted 716
2 SASI_Hs02_00324976 predicted 589
3 SASI_Hs02_00324977 predicted 660
4 SASI_Hs02_00324978 predicted 644
5 SASI_Hs02_00324979 predicted 420
6 SASI_Hs02_00324980 predicted 679
7 SASI_Hs02_00324981 predicted 602
8 SASI_Hs02_00324982 predicted 600
9 SASI_Hs02_00324983 predicted 847
10 SASI_Hs02_00324984 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059599 predicted 467
2 SASI_Rn01_00059600 predicted 323
3 SASI_Rn01_00059601 predicted 875
4 SASI_Rn01_00059602 predicted 572
5 SASI_Rn01_00059603 predicted 796
6 SASI_Rn02_00199241 predicted 630
7 SASI_Rn01_00059604 predicted 912
8 SASI_Rn01_00059605 predicted 880
9 SASI_Rn01_00059606 predicted 808
10 SASI_Rn01_00059607 predicted 561
11 SASI_Rn01_00059598 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172800 predicted 466
2 SASI_Rn01_00172801 predicted 325
3 SASI_Rn01_00172802 predicted 411
4 SASI_Rn01_00172803 predicted 390
5 SASI_Rn01_00172804 predicted 443
6 SASI_Rn01_00172805 predicted 362
7 SASI_Rn01_00172806 predicted 371
8 SASI_Rn01_00172807 predicted 404
9 SASI_Rn01_00172808 predicted 372
10 SASI_Rn01_00172809 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097832 predicted 548
2 SASI_Mm01_00097835 predicted 395
3 SASI_Mm01_00097837 predicted 454
4 SASI_Mm01_00097838 predicted 795
5 SASI_Mm01_00097833 predicted 596
6 SASI_Mm01_00097839 predicted 472
7 SASI_Mm02_00350037 predicted 575
8 SASI_Mm01_00097840 predicted 495
9 SASI_Mm01_00097841 predicted 663
10 SASI_Mm02_00350038 predicted 430
11 SASI_Mm01_00097834 predicted 586
12 SASI_Mm01_00097836 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001673
RNASE9 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 9 (non-active)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-454s1c1
Sequence:CCGGGCGTGTAAATACGAATCACTTCTCGAGAAGTGATTCGTATTTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-361s1c1
Sequence:CCGGGTGCCATGTAAGAATGGAATTCTCGAGAATTCCATTCTTACATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-71s1c1
Sequence:CCGGTGCAGTTTCAAGAGGTGGATACTCGAGTATCCACCTCTTGAAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-203s1c1
Sequence:CCGGGTGTCCTTATTGAACCTGGAACTCGAGTTCCAGGTTCAATAAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-225s1c1
Sequence:CCGGGCCACTAAATCATATAGAGTACTCGAGTACTCTATATGATTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001673
RNASE9 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 9 (non-active)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-454s1c1
Sequence:CCGGGCGTGTAAATACGAATCACTTCTCGAGAAGTGATTCGTATTTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-361s1c1
Sequence:CCGGGTGCCATGTAAGAATGGAATTCTCGAGAATTCCATTCTTACATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-71s1c1
Sequence:CCGGTGCAGTTTCAAGAGGTGGATACTCGAGTATCCACCTCTTGAAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-203s1c1
Sequence:CCGGGTGTCCTTATTGAACCTGGAACTCGAGTTCCAGGTTCAATAAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-225s1c1
Sequence:CCGGGCCACTAAATCATATAGAGTACTCGAGTACTCTATATGATTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001673
RNASE9 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 9 (non-active)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-454s1c1
Sequence:CCGGGCGTGTAAATACGAATCACTTCTCGAGAAGTGATTCGTATTTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-361s1c1
Sequence:CCGGGTGCCATGTAAGAATGGAATTCTCGAGAATTCCATTCTTACATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-71s1c1
Sequence:CCGGTGCAGTTTCAAGAGGTGGATACTCGAGTATCCACCTCTTGAAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-203s1c1
Sequence:CCGGGTGTCCTTATTGAACCTGGAACTCGAGTTCCAGGTTCAATAAGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001673.1-225s1c1
Sequence:CCGGGCCACTAAATCATATAGAGTACTCGAGTACTCTATATGATTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183032
RNASE9 MISSION shRNA Bacterial Glycerol Stock
ribonuclease, RNase A family, 9 (non-active)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-374s21c1
Sequence:CCGGGGACTAAACAGATTCACTATACTCGAGTATAGTGAATCTGTTTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-432s21c1
Sequence:CCGGGCCCTATGGTGAGCTAGTAAACTCGAGTTTACTAGCTCACCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-475s21c1
Sequence:CCGGCAATGTAAGAATGGCGTTAAACTCGAGTTTAACGCCATTCTTACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183032.2-775s21c1
Sequence:CCGGGAATGGTAGTTTGGGTCTATTCTCGAGAATAGACCCAAACTACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-282s21c1
Sequence:CCGGCACCAAACCACCTACCGTAAACTCGAGTTTACGGTAGGTGGTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183032
RNASE9 MISSION shRNA shRNA Plasmid DNA
ribonuclease, RNase A family, 9 (non-active)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-374s21c1
Sequence:CCGGGGACTAAACAGATTCACTATACTCGAGTATAGTGAATCTGTTTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-432s21c1
Sequence:CCGGGCCCTATGGTGAGCTAGTAAACTCGAGTTTACTAGCTCACCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-475s21c1
Sequence:CCGGCAATGTAAGAATGGCGTTAAACTCGAGTTTAACGCCATTCTTACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183032.2-775s21c1
Sequence:CCGGGAATGGTAGTTTGGGTCTATTCTCGAGAATAGACCCAAACTACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-282s21c1
Sequence:CCGGCACCAAACCACCTACCGTAAACTCGAGTTTACGGTAGGTGGTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183032
RNASE9 MISSION shRNA Lentiviral Transduction Particles
ribonuclease, RNase A family, 9 (non-active)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-374s21c1
Sequence:CCGGGGACTAAACAGATTCACTATACTCGAGTATAGTGAATCTGTTTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-432s21c1
Sequence:CCGGGCCCTATGGTGAGCTAGTAAACTCGAGTTTACTAGCTCACCATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-475s21c1
Sequence:CCGGCAATGTAAGAATGGCGTTAAACTCGAGTTTAACGCCATTCTTACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183032.2-775s21c1
Sequence:CCGGGAATGGTAGTTTGGGTCTATTCTCGAGAATAGACCCAAACTACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183032.2-282s21c1
Sequence:CCGGCACCAAACCACCTACCGTAAACTCGAGTTTACGGTAGGTGGTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks