EMAIL THIS PAGE TO A FRIEND

RNF114

ring finger protein 114

Synonyms: PSORS12 ZNF313
UniProtKB ID: Q9Y508, B2RDQ9, B4DWY5, E1P627, Q6N0B0
Gene ID:
Mouse(81018) ring finger protein 114
Rat(362277) ring finger protein 114
Zebrafish(414843) ring finger protein 114
chicken(414881) ring finger protein 114
dog(477261) ring finger protein 114
domestic cat(101101045) ring finger protein 114
domestic guinea pig(100726743) ring finger protein 114
naked mole-rat(101700225) ring finger protein 114
cow(513479) ring finger protein 114
sheep(101122045) ring finger protein 114
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081511 MISSION® esiRNA esiRNA targeting mouse Rnf114 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018683 Rosetta Predictions human pricing
NM_001001517 Rosetta Predictions rat pricing
XM_579060 Rosetta Predictions rat pricing
NM_030743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219042 predicted 427
2 SASI_Hs01_00219043 predicted 921
3 SASI_Hs01_00219044 predicted 734
4 SASI_Hs01_00219045 predicted 775
5 SASI_Hs01_00219046 predicted 476
6 SASI_Hs01_00219047 predicted 495
7 SASI_Hs01_00219048 predicted 435
8 SASI_Hs01_00219049 predicted 360
9 SASI_Hs02_00352196 predicted 313
10 SASI_Hs02_00352197 predicted 474
11 SASI_Hs01_00219050 predicted 481
12 SASI_Hs01_00219051 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081610 predicted 434
2 SASI_Rn01_00081611 predicted 725
3 SASI_Rn01_00081612 predicted 375
4 SASI_Rn02_00197919 predicted 769
5 SASI_Rn01_00081613 predicted 641
6 SASI_Rn01_00081615 predicted 413
7 SASI_Rn01_00081616 predicted 512
8 SASI_Rn01_00081617 predicted 465
9 SASI_Rn01_00081619 predicted 364
10 SASI_Rn02_00197920 predicted 479
11 SASI_Rn01_00081614 predicted 677
12 SASI_Rn01_00081618 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131396 predicted 734
2 SASI_Rn01_00131397 predicted 773
3 SASI_Rn01_00131398 predicted 677
4 SASI_Rn01_00131399 predicted 671
5 SASI_Rn01_00131400 predicted 907
6 SASI_Rn01_00131401 predicted 747
7 SASI_Rn01_00131402 predicted 884
8 SASI_Rn01_00131403 predicted 789
9 SASI_Rn01_00131404 predicted 435
10 SASI_Rn01_00131405 predicted 93
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103953 predicted 1153
2 SASI_Mm01_00103954 predicted 947
3 SASI_Mm01_00103955 predicted 1640
4 SASI_Mm01_00103956 predicted 1853
5 SASI_Mm01_00103957 predicted 1368
6 SASI_Mm01_00103958 predicted 1276
7 SASI_Mm01_00103960 predicted 1494
8 SASI_Mm02_00336938 predicted 1443
9 SASI_Mm01_00103961 predicted 1206
10 SASI_Mm01_00103962 predicted 1319
11 SASI_Mm01_00103959 predicted 1848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018683
VALIDATED
RNF114 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 114
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_018683.3-309s21c1
Sequence:CCGGCCATGGCTGCCGTAAGAATTTCTCGAGAAATTCTTACGGCAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018683.3-364s21c1
Sequence:CCGGTGTTCCAAATACCAGAATTACCTCGAGGTAATTCTGGTATTTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018683.3-600s21c1
Sequence:CCGGCGCCAACTTCAGAGAGCACATCTCGAGATGTGCTCTCTGAAGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018683.3-524s21c1
Sequence:CCGGTCCATAGCACGGATACCAAATCTCGAGATTTGGTATCCGTGCTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018683.3-947s21c1
Sequence:CCGGCACACGGTCGAGTTCGTATTGCTCGAGCAATACGAACTCGACCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018683.x-1720s1c1
Sequence:CCGGGCTTTGTAGATGCAGAGAGAACTCGAGTTCTCTCTGCATCTACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018683.x-569s1c1
Sequence:CCGGCGCCAACTTCAGAGAGCACATCTCGAGATGTGCTCTCTGAAGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018683.x-438s1c1
Sequence:CCGGTACTGTCCTGAGAAGAACTTTCTCGAGAAAGTTCTTCTCAGGACAGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018683.x-428s1c1
Sequence:CCGGTCCTTGTCCTTACTGTCCTGACTCGAGTCAGGACAGTAAGGACAAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018683.x-253s1c1
Sequence:CCGGAGATCGAGAGCACAGAGACTTCTCGAGAAGTCTCTGTGCTCTCGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018683
VALIDATED
RNF114 MISSION shRNA shRNA Plasmid DNA
ring finger protein 114
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_018683.3-309s21c1
Sequence:CCGGCCATGGCTGCCGTAAGAATTTCTCGAGAAATTCTTACGGCAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018683.3-364s21c1
Sequence:CCGGTGTTCCAAATACCAGAATTACCTCGAGGTAATTCTGGTATTTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018683.3-600s21c1
Sequence:CCGGCGCCAACTTCAGAGAGCACATCTCGAGATGTGCTCTCTGAAGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018683.3-524s21c1
Sequence:CCGGTCCATAGCACGGATACCAAATCTCGAGATTTGGTATCCGTGCTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018683.3-947s21c1
Sequence:CCGGCACACGGTCGAGTTCGTATTGCTCGAGCAATACGAACTCGACCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018683.x-1720s1c1
Sequence:CCGGGCTTTGTAGATGCAGAGAGAACTCGAGTTCTCTCTGCATCTACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018683.x-569s1c1
Sequence:CCGGCGCCAACTTCAGAGAGCACATCTCGAGATGTGCTCTCTGAAGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018683.x-438s1c1
Sequence:CCGGTACTGTCCTGAGAAGAACTTTCTCGAGAAAGTTCTTCTCAGGACAGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018683.x-428s1c1
Sequence:CCGGTCCTTGTCCTTACTGTCCTGACTCGAGTCAGGACAGTAAGGACAAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018683.x-253s1c1
Sequence:CCGGAGATCGAGAGCACAGAGACTTCTCGAGAAGTCTCTGTGCTCTCGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018683
VALIDATED
RNF114 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 114
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_018683.3-309s21c1
Sequence:CCGGCCATGGCTGCCGTAAGAATTTCTCGAGAAATTCTTACGGCAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018683.3-364s21c1
Sequence:CCGGTGTTCCAAATACCAGAATTACCTCGAGGTAATTCTGGTATTTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018683.3-600s21c1
Sequence:CCGGCGCCAACTTCAGAGAGCACATCTCGAGATGTGCTCTCTGAAGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018683.3-524s21c1
Sequence:CCGGTCCATAGCACGGATACCAAATCTCGAGATTTGGTATCCGTGCTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018683.3-947s21c1
Sequence:CCGGCACACGGTCGAGTTCGTATTGCTCGAGCAATACGAACTCGACCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018683.x-1720s1c1
Sequence:CCGGGCTTTGTAGATGCAGAGAGAACTCGAGTTCTCTCTGCATCTACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018683.x-569s1c1
Sequence:CCGGCGCCAACTTCAGAGAGCACATCTCGAGATGTGCTCTCTGAAGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018683.x-438s1c1
Sequence:CCGGTACTGTCCTGAGAAGAACTTTCTCGAGAAAGTTCTTCTCAGGACAGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018683.x-428s1c1
Sequence:CCGGTCCTTGTCCTTACTGTCCTGACTCGAGTCAGGACAGTAAGGACAAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018683.x-253s1c1
Sequence:CCGGAGATCGAGAGCACAGAGACTTCTCGAGAAGTCTCTGTGCTCTCGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030743
VALIDATED
RNF114 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 114
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030743.5-1205s21c1
Sequence:CCGGCATGTTCCAAATACCAGAATTCTCGAGAATTCTGGTATTTGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1225s21c1
Sequence:GTACCGGTACATCATGGAAGGTGTAAAGCTCGAGCTTTACACCTTCCATGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1152s21c1
Sequence:CCGGCCATGGCTGCCGTAAGAATTTCTCGAGAAATTCTTACGGCAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030743.5-2087s21c1
Sequence:CCGGTGTACACCTGAGGGCTTAAATCTCGAGATTTAAGCCCTCAGGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1513s21c1
Sequence:CCGGGATGAAGATGACATGATAAACCTCGAGGTTTATCATGTCATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1198s21c1
Sequence:CCGGGTGACGTCATGTTCCAAATACCTCGAGGTATTTGGAACATGACGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030743.3-307s1c1
Sequence:CCGGGCCGTAAGAATTTCATCCTATCTCGAGATAGGATGAAATTCTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030743.3-523s1c1
Sequence:CCGGCCGATACCAAGTCTGTGGTTTCTCGAGAAACCACAGACTTGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030743.3-416s1c1
Sequence:CCGGTCAGCCGAGAAACATCCCAAACTCGAGTTTGGGATGTTTCTCGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030743.3-277s1c1
Sequence:CCGGTCGAGAGCATAGAGACTTCTTCTCGAGAAGAAGTCTCTATGCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030743.3-352s1c1
Sequence:CCGGCATGTTCCAAATACCAGAATTCTCGAGAATTCTGGTATTTGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030743
VALIDATED
RNF114 MISSION shRNA shRNA Plasmid DNA
ring finger protein 114
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030743.5-1205s21c1
Sequence:CCGGCATGTTCCAAATACCAGAATTCTCGAGAATTCTGGTATTTGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1225s21c1
Sequence:GTACCGGTACATCATGGAAGGTGTAAAGCTCGAGCTTTACACCTTCCATGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1152s21c1
Sequence:CCGGCCATGGCTGCCGTAAGAATTTCTCGAGAAATTCTTACGGCAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030743.5-2087s21c1
Sequence:CCGGTGTACACCTGAGGGCTTAAATCTCGAGATTTAAGCCCTCAGGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1513s21c1
Sequence:CCGGGATGAAGATGACATGATAAACCTCGAGGTTTATCATGTCATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1198s21c1
Sequence:CCGGGTGACGTCATGTTCCAAATACCTCGAGGTATTTGGAACATGACGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030743.3-307s1c1
Sequence:CCGGGCCGTAAGAATTTCATCCTATCTCGAGATAGGATGAAATTCTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030743.3-523s1c1
Sequence:CCGGCCGATACCAAGTCTGTGGTTTCTCGAGAAACCACAGACTTGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030743.3-416s1c1
Sequence:CCGGTCAGCCGAGAAACATCCCAAACTCGAGTTTGGGATGTTTCTCGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030743.3-277s1c1
Sequence:CCGGTCGAGAGCATAGAGACTTCTTCTCGAGAAGAAGTCTCTATGCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030743.3-352s1c1
Sequence:CCGGCATGTTCCAAATACCAGAATTCTCGAGAATTCTGGTATTTGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030743
VALIDATED
RNF114 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 114
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030743.5-1205s21c1
Sequence:CCGGCATGTTCCAAATACCAGAATTCTCGAGAATTCTGGTATTTGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1225s21c1
Sequence:GTACCGGTACATCATGGAAGGTGTAAAGCTCGAGCTTTACACCTTCCATGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1152s21c1
Sequence:CCGGCCATGGCTGCCGTAAGAATTTCTCGAGAAATTCTTACGGCAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030743.5-2087s21c1
Sequence:CCGGTGTACACCTGAGGGCTTAAATCTCGAGATTTAAGCCCTCAGGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1513s21c1
Sequence:CCGGGATGAAGATGACATGATAAACCTCGAGGTTTATCATGTCATCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030743.5-1198s21c1
Sequence:CCGGGTGACGTCATGTTCCAAATACCTCGAGGTATTTGGAACATGACGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030743.3-307s1c1
Sequence:CCGGGCCGTAAGAATTTCATCCTATCTCGAGATAGGATGAAATTCTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030743.3-523s1c1
Sequence:CCGGCCGATACCAAGTCTGTGGTTTCTCGAGAAACCACAGACTTGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030743.3-416s1c1
Sequence:CCGGTCAGCCGAGAAACATCCCAAACTCGAGTTTGGGATGTTTCTCGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030743.3-277s1c1
Sequence:CCGGTCGAGAGCATAGAGACTTCTTCTCGAGAAGAAGTCTCTATGCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030743.3-352s1c1
Sequence:CCGGCATGTTCCAAATACCAGAATTCTCGAGAATTCTGGTATTTGGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks