EMAIL THIS PAGE TO A FRIEND

RNF135

ring finger protein 135

Synonyms: MMFD REUL Riplet
UniProtKB ID: Q8IUD6, A0AVM5, B2R7G9, B6ZLM5, F5GX60, Q9BSE9
Gene ID:
Human(84282) Summary: The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. This gene is located in a chromosomal region known to be frequently deleted in patients with neurofibromatosis. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(71956) ring finger protein 135
Rat(303350) ring finger protein 135
cow(511125) ring finger protein 135
sheep(101116159) ring finger protein 135
domestic guinea pig(100718859) ring finger protein 135
naked mole-rat(101723474) ring finger protein 135
dog(480614) ring finger protein 135
Horse(100071806) ring finger protein 135
domestic cat(101094145) ring finger protein 135
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032322 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133761 MISSION® esiRNA esiRNA human RNF135 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032322 Rosetta Predictions human pricing
NM_197939 Rosetta Predictions human pricing
NM_001012010 Rosetta Predictions rat pricing
XM_573156 Rosetta Predictions rat pricing
NM_028019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153023 predicted 1263
2 SASI_Hs01_00153024 predicted 1197
3 SASI_Hs02_00359686 predicted 1163
4 SASI_Hs01_00153025 predicted 1163
5 SASI_Hs01_00153026 predicted 1202
6 SASI_Hs01_00153027 predicted 1266
7 SASI_Hs01_00153029 predicted 1112
8 SASI_Hs01_00153031 predicted 1197
9 SASI_Hs02_00359687 predicted 1165
10 SASI_Hs01_00153032 predicted 1274
11 SASI_Hs01_00153028 predicted 1286
12 SASI_Hs01_00153030 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058651 predicted 1095
2 SASI_Hs01_00058652 predicted 1035
3 SASI_Hs02_00371545 predicted 1005
4 SASI_Hs01_00058653 predicted 1002
5 SASI_Hs01_00058654 predicted 1040
6 SASI_Hs01_00058655 predicted 1108
7 SASI_Hs01_00058657 predicted 951
8 SASI_Hs01_00058659 predicted 1032
9 SASI_Hs02_00371546 predicted 1002
10 SASI_Hs01_00058660 predicted 1113
11 SASI_Hs01_00058656 predicted 1129
12 SASI_Hs01_00058658 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200089 predicted 547
2 SASI_Rn02_00200090 predicted 1323
3 SASI_Rn01_00049325 predicted 1029
4 SASI_Rn01_00049326 predicted 1262
5 SASI_Rn01_00049327 predicted 1356
6 SASI_Rn01_00049328 predicted 813
7 SASI_Rn01_00049329 predicted 678
8 SASI_Rn01_00049330 predicted 905
9 SASI_Rn01_00049331 predicted 886
10 SASI_Rn01_00049332 predicted 1186
11 SASI_Rn01_00049324 predicted 1277
12 SASI_Rn01_00049333 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173384 predicted 1748
2 SASI_Rn01_00173385 predicted 1683
3 SASI_Rn01_00173386 predicted 1862
4 SASI_Rn01_00173387 predicted 1804
5 SASI_Rn01_00173388 predicted 1752
6 SASI_Rn01_00173389 predicted 163
7 SASI_Rn01_00173390 predicted 1158
8 SASI_Rn01_00173391 predicted 1392
9 SASI_Rn01_00173392 predicted 1494
10 SASI_Rn01_00173393 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100878 predicted 1353
2 SASI_Mm01_00100880 predicted 1188
3 SASI_Mm01_00100881 predicted 1251
4 SASI_Mm01_00100883 predicted 667
5 SASI_Mm01_00100884 predicted 687
6 SASI_Mm01_00100885 predicted 993
7 SASI_Mm02_00333155 predicted 543
8 SASI_Mm01_00100886 predicted 426
9 SASI_Mm01_00100887 predicted 746
10 SASI_Mm02_00333156 predicted 1060
11 SASI_Mm01_00100879 predicted 562
12 SASI_Mm01_00100882 predicted 1380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032322
RNF135 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 135
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032322.3-1910s21c1
Sequence:CCGGATGTGATCAATCCCTAGTAAACTCGAGTTTACTAGGGATTGATCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032322.3-1483s21c1
Sequence:CCGGGTCATCAATCAGGGTAGTAACCTCGAGGTTACTACCCTGATTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033999    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032322.3-2076s1c1
Sequence:CCGGCTTACCTTATGTGCCTTTCTTCTCGAGAAGAAAGGCACATAAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-1310s1c1
Sequence:CCGGGTGGACAATCAGGAGAAGCTTCTCGAGAAGCTTCTCCTGATTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-1171s1c1
Sequence:CCGGCTCTTGTTGTGTGGAATGGAACTCGAGTTCCATTCCACACAACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-512s1c1
Sequence:CCGGGCAGTAGAGAAGAGCATCACACTCGAGTGTGATGCTCTTCTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-910s1c1
Sequence:CCGGCATCCATCCAACCTTTAACTTCTCGAGAAGTTAAAGGTTGGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032322
RNF135 MISSION shRNA shRNA Plasmid DNA
ring finger protein 135
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032322.3-1910s21c1
Sequence:CCGGATGTGATCAATCCCTAGTAAACTCGAGTTTACTAGGGATTGATCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032322.3-1483s21c1
Sequence:CCGGGTCATCAATCAGGGTAGTAACCTCGAGGTTACTACCCTGATTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033999    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032322.3-2076s1c1
Sequence:CCGGCTTACCTTATGTGCCTTTCTTCTCGAGAAGAAAGGCACATAAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-1310s1c1
Sequence:CCGGGTGGACAATCAGGAGAAGCTTCTCGAGAAGCTTCTCCTGATTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-1171s1c1
Sequence:CCGGCTCTTGTTGTGTGGAATGGAACTCGAGTTCCATTCCACACAACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-512s1c1
Sequence:CCGGGCAGTAGAGAAGAGCATCACACTCGAGTGTGATGCTCTTCTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-910s1c1
Sequence:CCGGCATCCATCCAACCTTTAACTTCTCGAGAAGTTAAAGGTTGGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032322
RNF135 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 135
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032322.3-1910s21c1
Sequence:CCGGATGTGATCAATCCCTAGTAAACTCGAGTTTACTAGGGATTGATCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032322.3-1483s21c1
Sequence:CCGGGTCATCAATCAGGGTAGTAACCTCGAGGTTACTACCCTGATTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033999    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032322.3-2076s1c1
Sequence:CCGGCTTACCTTATGTGCCTTTCTTCTCGAGAAGAAAGGCACATAAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-1310s1c1
Sequence:CCGGGTGGACAATCAGGAGAAGCTTCTCGAGAAGCTTCTCCTGATTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-1171s1c1
Sequence:CCGGCTCTTGTTGTGTGGAATGGAACTCGAGTTCCATTCCACACAACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-512s1c1
Sequence:CCGGGCAGTAGAGAAGAGCATCACACTCGAGTGTGATGCTCTTCTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032322.3-910s1c1
Sequence:CCGGCATCCATCCAACCTTTAACTTCTCGAGAAGTTAAAGGTTGGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028019
VALIDATED
RNF135 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 135
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028019.3-1364s21c1
Sequence:CCGGACTTAGGGAGACTGGATATAGCTCGAGCTATATCCAGTCTCCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028019.3-94s21c1
Sequence:CCGGGACGACCTGAGCTGCATTATCCTCGAGGATAATGCAGCTCAGGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028019.3-1272s21c1
Sequence:CCGGCCTGGAAATAAAGCAGCTAAACTCGAGTTTAGCTGCTTTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028019.3-576s21c1
Sequence:CCGGGACCTTCAGTATATCTCAGAACTCGAGTTCTGAGATATACTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028019.3-451s21c1
Sequence:CCGGGACGATGTCAAGAGCCTTCAACTCGAGTTGAAGGCTCTTGACATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028019.1-1274s1c1
Sequence:CCGGCCTGGAAATAAAGCAGCTAAACTCGAGTTTAGCTGCTTTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028019.1-453s1c1
Sequence:CCGGGACGATGTCAAGAGCCTTCAACTCGAGTTGAAGGCTCTTGACATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028019.1-923s1c1
Sequence:CCGGCCTCTCATCTGGACAGAAGTACTCGAGTACTTCTGTCCAGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028019.1-578s1c1
Sequence:CCGGGACCTTCAGTATATCTCAGAACTCGAGTTCTGAGATATACTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028019.1-615s1c1
Sequence:CCGGCTCCATAACCTGGAAGAAATTCTCGAGAATTTCTTCCAGGTTATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028019
VALIDATED
RNF135 MISSION shRNA shRNA Plasmid DNA
ring finger protein 135
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028019.3-1364s21c1
Sequence:CCGGACTTAGGGAGACTGGATATAGCTCGAGCTATATCCAGTCTCCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028019.3-94s21c1
Sequence:CCGGGACGACCTGAGCTGCATTATCCTCGAGGATAATGCAGCTCAGGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028019.3-1272s21c1
Sequence:CCGGCCTGGAAATAAAGCAGCTAAACTCGAGTTTAGCTGCTTTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028019.3-576s21c1
Sequence:CCGGGACCTTCAGTATATCTCAGAACTCGAGTTCTGAGATATACTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028019.3-451s21c1
Sequence:CCGGGACGATGTCAAGAGCCTTCAACTCGAGTTGAAGGCTCTTGACATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028019.1-1274s1c1
Sequence:CCGGCCTGGAAATAAAGCAGCTAAACTCGAGTTTAGCTGCTTTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028019.1-453s1c1
Sequence:CCGGGACGATGTCAAGAGCCTTCAACTCGAGTTGAAGGCTCTTGACATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028019.1-923s1c1
Sequence:CCGGCCTCTCATCTGGACAGAAGTACTCGAGTACTTCTGTCCAGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028019.1-578s1c1
Sequence:CCGGGACCTTCAGTATATCTCAGAACTCGAGTTCTGAGATATACTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028019.1-615s1c1
Sequence:CCGGCTCCATAACCTGGAAGAAATTCTCGAGAATTTCTTCCAGGTTATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028019
VALIDATED
RNF135 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 135
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028019.3-1364s21c1
Sequence:CCGGACTTAGGGAGACTGGATATAGCTCGAGCTATATCCAGTCTCCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028019.3-94s21c1
Sequence:CCGGGACGACCTGAGCTGCATTATCCTCGAGGATAATGCAGCTCAGGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028019.3-1272s21c1
Sequence:CCGGCCTGGAAATAAAGCAGCTAAACTCGAGTTTAGCTGCTTTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028019.3-576s21c1
Sequence:CCGGGACCTTCAGTATATCTCAGAACTCGAGTTCTGAGATATACTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028019.3-451s21c1
Sequence:CCGGGACGATGTCAAGAGCCTTCAACTCGAGTTGAAGGCTCTTGACATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028019.1-1274s1c1
Sequence:CCGGCCTGGAAATAAAGCAGCTAAACTCGAGTTTAGCTGCTTTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028019.1-453s1c1
Sequence:CCGGGACGATGTCAAGAGCCTTCAACTCGAGTTGAAGGCTCTTGACATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028019.1-923s1c1
Sequence:CCGGCCTCTCATCTGGACAGAAGTACTCGAGTACTTCTGTCCAGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028019.1-578s1c1
Sequence:CCGGGACCTTCAGTATATCTCAGAACTCGAGTTCTGAGATATACTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028019.1-615s1c1
Sequence:CCGGCTCCATAACCTGGAAGAAATTCTCGAGAATTTCTTCCAGGTTATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks