EMAIL THIS PAGE TO A FRIEND

RNF157

ring finger protein 157

UniProtKB ID: Q96PX1, Q8NB72, Q96N56
Gene ID:
Mouse(217340) ring finger protein 157
Rat(688272) ring finger protein 157
chicken(429219) ring finger protein 157
Horse(100059033) ring finger protein 157
domestic cat(101096933) ring finger protein 157
dog(483327) ring finger protein 157
domestic guinea pig(100723130) ring finger protein 157
naked mole-rat(101709224) ring finger protein 157
Domestic Rabbit(100358569) ring finger protein 157
cow(507697) ring finger protein 157
sheep(101117601) ring finger protein 157
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_290732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290732 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001003576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001003576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001003576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083241 MISSION® esiRNA esiRNA human RNF157 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052916 Rosetta Predictions human pricing
XM_001081716 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082768 predicted 813
2 SASI_Hs01_00082770 predicted 1147
3 SASI_Hs02_00361672 predicted 633
4 SASI_Hs01_00082772 predicted 318
5 SASI_Hs01_00082773 predicted 2003
6 SASI_Hs01_00082774 predicted 746
7 SASI_Hs01_00082775 predicted 1089
8 SASI_Hs01_00082776 predicted 708
9 SASI_Hs01_00082777 predicted 1477
10 SASI_Hs02_00361673 predicted 469
11 SASI_Hs01_00082769 predicted 1901
12 SASI_Hs01_00082771 predicted 1927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373135 predicted 1008
2 SASI_Rn02_00373136 predicted 981
3 SASI_Rn02_00373137 predicted 674
4 SASI_Rn02_00373138 predicted 474
5 SASI_Rn02_00373139 predicted 1538
6 SASI_Rn02_00373140 predicted 1851
7 SASI_Rn02_00373141 predicted 317
8 SASI_Rn02_00373142 predicted 1234
9 SASI_Rn02_00373143 predicted 1862
10 SASI_Rn02_00373144 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290732
RNF157 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 157
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000016739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290732.3-3157s1c1
Sequence:CCGGGCAGAGGGAAATGATGTTATACTCGAGTATAACATCATTTCCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290732.3-1783s1c1
Sequence:CCGGGCCACGGAAGAGTTCCAGAATCTCGAGATTCTGGAACTCTTCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290732.3-96s1c1
Sequence:CCGGCATCCCGTCTAATTCCGTGTACTCGAGTACACGGAATTAGACGGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290732
RNF157 MISSION shRNA shRNA Plasmid DNA
ring finger protein 157
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000016739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290732.3-3157s1c1
Sequence:CCGGGCAGAGGGAAATGATGTTATACTCGAGTATAACATCATTTCCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290732.3-1783s1c1
Sequence:CCGGGCCACGGAAGAGTTCCAGAATCTCGAGATTCTGGAACTCTTCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290732.3-96s1c1
Sequence:CCGGCATCCCGTCTAATTCCGTGTACTCGAGTACACGGAATTAGACGGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290732
RNF157 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 157
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000016739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290732.3-3157s1c1
Sequence:CCGGGCAGAGGGAAATGATGTTATACTCGAGTATAACATCATTTCCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290732.3-1783s1c1
Sequence:CCGGGCCACGGAAGAGTTCCAGAATCTCGAGATTCTGGAACTCTTCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290732.3-96s1c1
Sequence:CCGGCATCCCGTCTAATTCCGTGTACTCGAGTACACGGAATTAGACGGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001003576
VALIDATED
RNF157 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 157
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003576.1-648s21c1
Sequence:CCGGAGGAGATGCCGTGGAGTATTTCTCGAGAAATACTCCACGGCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_001003576.1-877s21c1
Sequence:CCGGTCTGACGTCCGCGATACTTTGCTCGAGCAAAGTATCGCGGACGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001003576.1-4900s21c1
Sequence:CCGGGGCCGTTTCTGCGGATTATAACTCGAGTTATAATCCGCAGAAACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_001003576.1-1895s21c1
Sequence:CCGGTTGACGTCGCAAGCGTGAAAGCTCGAGCTTTCACGCTTGCGACGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_001003576.1-1790s21c1
Sequence:GTACCGGCAGAGGGAAATGATATCATAGCTCGAGCTATGATATCATTTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001003576
VALIDATED
RNF157 MISSION shRNA shRNA Plasmid DNA
ring finger protein 157
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003576.1-648s21c1
Sequence:CCGGAGGAGATGCCGTGGAGTATTTCTCGAGAAATACTCCACGGCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_001003576.1-877s21c1
Sequence:CCGGTCTGACGTCCGCGATACTTTGCTCGAGCAAAGTATCGCGGACGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001003576.1-4900s21c1
Sequence:CCGGGGCCGTTTCTGCGGATTATAACTCGAGTTATAATCCGCAGAAACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_001003576.1-1895s21c1
Sequence:CCGGTTGACGTCGCAAGCGTGAAAGCTCGAGCTTTCACGCTTGCGACGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_001003576.1-1790s21c1
Sequence:GTACCGGCAGAGGGAAATGATATCATAGCTCGAGCTATGATATCATTTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001003576
VALIDATED
RNF157 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 157
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003576.1-648s21c1
Sequence:CCGGAGGAGATGCCGTGGAGTATTTCTCGAGAAATACTCCACGGCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_001003576.1-877s21c1
Sequence:CCGGTCTGACGTCCGCGATACTTTGCTCGAGCAAAGTATCGCGGACGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001003576.1-4900s21c1
Sequence:CCGGGGCCGTTTCTGCGGATTATAACTCGAGTTATAATCCGCAGAAACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_001003576.1-1895s21c1
Sequence:CCGGTTGACGTCGCAAGCGTGAAAGCTCGAGCTTTCACGCTTGCGACGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_001003576.1-1790s21c1
Sequence:GTACCGGCAGAGGGAAATGATATCATAGCTCGAGCTATGATATCATTTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks