EMAIL THIS PAGE TO A FRIEND

RNF167

ring finger protein 167

Synonyms: 5730408C10Rik RING105
UniProtKB ID: Q9H6Y7, D3DTK8, Q6XYE0, Q8NDC1, Q9Y3V1
Gene ID:
Human(26001) Summary: RNF167 is an E3 ubiquitin ligase that interacts with TSSC5 (SLC22A18; MIM 602631) and, together with UBCH6 (UBE2E1; MIM 602916), facilitates TSSC5 polyubiquitylation (Yamada and Gorbsky, 2006 [PubMed 16314844]
Mouse(70510) ring finger protein 167
Rat(360554) ring finger protein 167
cow(616030) ring finger protein 167
sheep(101109627) ring finger protein 167
naked mole-rat(101718491) ring finger protein 167
domestic guinea pig(100717812) ring finger protein 167
Zebrafish(101055497) ring finger protein 167
domestic cat(101092063) ring finger protein 167
dog(489456) ring finger protein 167
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015528 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025631 MISSION® esiRNA esiRNA human RNF167 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015528 Rosetta Predictions human pricing
NM_001008361 Rosetta Predictions rat pricing
NM_027445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201491 predicted 784
2 SASI_Hs01_00201492 predicted 1135
3 SASI_Hs01_00201493 predicted 1084
4 SASI_Hs02_00348029 predicted 1136
5 SASI_Hs01_00201494 predicted 1010
6 SASI_Hs01_00201495 predicted 675
7 SASI_Hs01_00201497 predicted 794
8 SASI_Hs01_00201498 predicted 1012
9 SASI_Hs01_00201499 predicted 1123
10 SASI_Hs01_00201500 predicted 981
11 SASI_Hs01_00201496 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065974 predicted 969
2 SASI_Rn01_00065975 predicted 995
3 SASI_Rn01_00065976 predicted 980
4 SASI_Rn01_00065977 predicted 1042
5 SASI_Rn01_00065978 predicted 1030
6 SASI_Rn01_00065979 predicted 949
7 SASI_Rn01_00065980 predicted 1302
8 SASI_Rn01_00065981 predicted 1247
9 SASI_Rn01_00065982 predicted 1032
10 SASI_Rn01_00065983 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175703 predicted 378
2 SASI_Mm01_00175704 predicted 1171
3 SASI_Mm01_00175705 predicted 614
4 SASI_Mm01_00175706 predicted 680
5 SASI_Mm01_00175708 predicted 713
6 SASI_Mm01_00175709 predicted 510
7 SASI_Mm01_00175710 predicted 897
8 SASI_Mm01_00175711 predicted 912
9 SASI_Mm02_00332199 predicted 919
10 SASI_Mm02_00332200 predicted 1220
11 SASI_Mm01_00175707 predicted 679
12 SASI_Mm01_00175712 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027445
VALIDATED
RNF167 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 167
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-971s21c1
Sequence:CCGGGCCATCTGTCTGGATGAATATCTCGAGATATTCATCCAGACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-512s21c1
Sequence:CCGGGTCAATGGGTCAGTCTTTATTCTCGAGAATAAAGACTGACCCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027445.1-1343s21c1
Sequence:CCGGCTCTGGTGACCGTCCTATTTGCTCGAGCAAATAGGACGGTCACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-542s21c1
Sequence:CCGGCGAAGATTCGACTGCAACTTTCTCGAGAAAGTTGCAGTCGAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-785s21c1
Sequence:CCGGCCCTTGGGCTATTACCTCATTCTCGAGAATGAGGTAATAGCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-1378s1c1
Sequence:CCGGCCAGTCTAATAAGCTGAGGGTCTCGAGACCCTCAGCTTATTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-971s1c1
Sequence:CCGGGCCATCTGTCTGGATGAATATCTCGAGATATTCATCCAGACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-785s1c1
Sequence:CCGGCCCTTGGGCTATTACCTCATTCTCGAGAATGAGGTAATAGCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-902s1c1
Sequence:CCGGCTTACCAAAGAGCAACTGAAACTCGAGTTTCAGTTGCTCTTTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-542s1c1
Sequence:CCGGCGAAGATTCGACTGCAACTTTCTCGAGAAAGTTGCAGTCGAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027445
VALIDATED
RNF167 MISSION shRNA shRNA Plasmid DNA
ring finger protein 167
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-971s21c1
Sequence:CCGGGCCATCTGTCTGGATGAATATCTCGAGATATTCATCCAGACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-512s21c1
Sequence:CCGGGTCAATGGGTCAGTCTTTATTCTCGAGAATAAAGACTGACCCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027445.1-1343s21c1
Sequence:CCGGCTCTGGTGACCGTCCTATTTGCTCGAGCAAATAGGACGGTCACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-542s21c1
Sequence:CCGGCGAAGATTCGACTGCAACTTTCTCGAGAAAGTTGCAGTCGAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-785s21c1
Sequence:CCGGCCCTTGGGCTATTACCTCATTCTCGAGAATGAGGTAATAGCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-1378s1c1
Sequence:CCGGCCAGTCTAATAAGCTGAGGGTCTCGAGACCCTCAGCTTATTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-971s1c1
Sequence:CCGGGCCATCTGTCTGGATGAATATCTCGAGATATTCATCCAGACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-785s1c1
Sequence:CCGGCCCTTGGGCTATTACCTCATTCTCGAGAATGAGGTAATAGCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-902s1c1
Sequence:CCGGCTTACCAAAGAGCAACTGAAACTCGAGTTTCAGTTGCTCTTTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-542s1c1
Sequence:CCGGCGAAGATTCGACTGCAACTTTCTCGAGAAAGTTGCAGTCGAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027445
VALIDATED
RNF167 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 167
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-971s21c1
Sequence:CCGGGCCATCTGTCTGGATGAATATCTCGAGATATTCATCCAGACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-512s21c1
Sequence:CCGGGTCAATGGGTCAGTCTTTATTCTCGAGAATAAAGACTGACCCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027445.1-1343s21c1
Sequence:CCGGCTCTGGTGACCGTCCTATTTGCTCGAGCAAATAGGACGGTCACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-542s21c1
Sequence:CCGGCGAAGATTCGACTGCAACTTTCTCGAGAAAGTTGCAGTCGAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027445.1-785s21c1
Sequence:CCGGCCCTTGGGCTATTACCTCATTCTCGAGAATGAGGTAATAGCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-1378s1c1
Sequence:CCGGCCAGTCTAATAAGCTGAGGGTCTCGAGACCCTCAGCTTATTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-971s1c1
Sequence:CCGGGCCATCTGTCTGGATGAATATCTCGAGATATTCATCCAGACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-785s1c1
Sequence:CCGGCCCTTGGGCTATTACCTCATTCTCGAGAATGAGGTAATAGCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-902s1c1
Sequence:CCGGCTTACCAAAGAGCAACTGAAACTCGAGTTTCAGTTGCTCTTTGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027445.1-542s1c1
Sequence:CCGGCGAAGATTCGACTGCAACTTTCTCGAGAAAGTTGCAGTCGAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015528
VALIDATED
RNF167 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 167
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1059s21c1
Sequence:CCGGCAGCGGAATCGACTTACCAAACTCGAGTTTGGTAAGTCGATTCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1602s21c1
Sequence:CCGGCCTTACCCACACCTATCCTTTCTCGAGAAAGGATAGGTGTGGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-678s21c1
Sequence:CCGGCCGGTCAATGGGTCAGTCTTTCTCGAGAAAGACTGACCCATTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1091s21c1
Sequence:CCGGACAGATTCCTACACATGACTACTCGAGTAGTCATGTGTAGGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1018s21c1
Sequence:CCGGCAGTAATGATAGCTCGTTGTACTCGAGTACAACGAGCTATCATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015528.x-1602s1c1
Sequence:CCGGCCTTACCCACACCTATCCTTTCTCGAGAAAGGATAGGTGTGGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015528.x-1091s1c1
Sequence:CCGGACAGATTCCTACACATGACTACTCGAGTAGTCATGTGTAGGAATCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015528.x-1059s1c1
Sequence:CCGGCAGCGGAATCGACTTACCAAACTCGAGTTTGGTAAGTCGATTCCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015528.x-1018s1c1
Sequence:CCGGCAGTAATGATAGCTCGTTGTACTCGAGTACAACGAGCTATCATTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015528.x-678s1c1
Sequence:CCGGCCGGTCAATGGGTCAGTCTTTCTCGAGAAAGACTGACCCATTGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015528
VALIDATED
RNF167 MISSION shRNA shRNA Plasmid DNA
ring finger protein 167
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1059s21c1
Sequence:CCGGCAGCGGAATCGACTTACCAAACTCGAGTTTGGTAAGTCGATTCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1602s21c1
Sequence:CCGGCCTTACCCACACCTATCCTTTCTCGAGAAAGGATAGGTGTGGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-678s21c1
Sequence:CCGGCCGGTCAATGGGTCAGTCTTTCTCGAGAAAGACTGACCCATTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1091s21c1
Sequence:CCGGACAGATTCCTACACATGACTACTCGAGTAGTCATGTGTAGGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1018s21c1
Sequence:CCGGCAGTAATGATAGCTCGTTGTACTCGAGTACAACGAGCTATCATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015528.x-1602s1c1
Sequence:CCGGCCTTACCCACACCTATCCTTTCTCGAGAAAGGATAGGTGTGGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015528.x-1091s1c1
Sequence:CCGGACAGATTCCTACACATGACTACTCGAGTAGTCATGTGTAGGAATCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015528.x-1059s1c1
Sequence:CCGGCAGCGGAATCGACTTACCAAACTCGAGTTTGGTAAGTCGATTCCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015528.x-1018s1c1
Sequence:CCGGCAGTAATGATAGCTCGTTGTACTCGAGTACAACGAGCTATCATTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015528.x-678s1c1
Sequence:CCGGCCGGTCAATGGGTCAGTCTTTCTCGAGAAAGACTGACCCATTGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015528
VALIDATED
RNF167 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 167
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1059s21c1
Sequence:CCGGCAGCGGAATCGACTTACCAAACTCGAGTTTGGTAAGTCGATTCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1602s21c1
Sequence:CCGGCCTTACCCACACCTATCCTTTCTCGAGAAAGGATAGGTGTGGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-678s21c1
Sequence:CCGGCCGGTCAATGGGTCAGTCTTTCTCGAGAAAGACTGACCCATTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1091s21c1
Sequence:CCGGACAGATTCCTACACATGACTACTCGAGTAGTCATGTGTAGGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015528.1-1018s21c1
Sequence:CCGGCAGTAATGATAGCTCGTTGTACTCGAGTACAACGAGCTATCATTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015528.x-1602s1c1
Sequence:CCGGCCTTACCCACACCTATCCTTTCTCGAGAAAGGATAGGTGTGGGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015528.x-1091s1c1
Sequence:CCGGACAGATTCCTACACATGACTACTCGAGTAGTCATGTGTAGGAATCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015528.x-1059s1c1
Sequence:CCGGCAGCGGAATCGACTTACCAAACTCGAGTTTGGTAAGTCGATTCCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015528.x-1018s1c1
Sequence:CCGGCAGTAATGATAGCTCGTTGTACTCGAGTACAACGAGCTATCATTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015528.x-678s1c1
Sequence:CCGGCCGGTCAATGGGTCAGTCTTTCTCGAGAAAGACTGACCCATTGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks