EMAIL THIS PAGE TO A FRIEND

RNF182

ring finger protein 182

UniProtKB ID: Q8N6D2, B2RDG2, Q8NBG3
Gene ID:
Mouse(328234) ring finger protein 182
Rat(498726) ring finger protein 182
cow(518996) ring finger protein 182
sheep(101103600) ring finger protein 182
naked mole-rat(101717638) ring finger protein 182
domestic guinea pig(100718581) ring finger protein 182
chicken(771221) ring finger protein 182
domestic cat(101089106) ring finger protein 182
dog(488225) ring finger protein 182
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152737 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152737 Rosetta Predictions human pricing
NM_001109117 Rosetta Predictions rat pricing
NM_183204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091635 predicted 1249
2 SASI_Hs01_00091636 predicted 477
3 SASI_Hs01_00091637 predicted 530
4 SASI_Hs01_00091638 predicted 1081
5 SASI_Hs01_00091640 predicted 1021
6 SASI_Hs01_00091641 predicted 686
7 SASI_Hs01_00091642 predicted 487
8 SASI_Hs01_00091644 predicted 964
9 SASI_Hs02_00366654 predicted 1252
10 SASI_Hs02_00366655 predicted 520
11 SASI_Hs01_00091639 predicted 1199
12 SASI_Hs01_00091643 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245290 predicted 851
2 SASI_Rn02_00245291 predicted 320
3 SASI_Rn02_00245292 predicted 887
4 SASI_Rn02_00245293 predicted 536
5 SASI_Rn02_00245294 predicted 952
6 SASI_Rn02_00245295 predicted 475
7 SASI_Rn02_00245296 predicted 887
8 SASI_Rn02_00245297 predicted 990
9 SASI_Rn02_00245298 predicted 490
10 SASI_Rn02_00245299 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026455 predicted 352
2 SASI_Mm02_00350313 predicted 439
3 SASI_Mm01_00026456 predicted 669
4 SASI_Mm01_00026457 predicted 890
5 SASI_Mm01_00026458 predicted 900
6 SASI_Mm02_00350314 predicted 434
7 SASI_Mm01_00026459 predicted 411
8 SASI_Mm01_00026460 predicted 991
9 SASI_Mm01_00026461 predicted 885
10 SASI_Mm01_00026462 predicted 998
11 SASI_Mm01_00026463 predicted 857
12 SASI_Mm01_00026464 predicted 971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152737
VALIDATED
RNF182 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 182
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-667s1c1
Sequence:CCGGCCCGATGACAACAACATCCTTCTCGAGAAGGATGTTGTTGTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152737.1-533s1c1
Sequence:CCGGTGGAGTGTTGTCATAGGGTTTCTCGAGAAACCCTATGACAACACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-948s1c1
Sequence:CCGGCCTGCTGTTTCAGACATCCATCTCGAGATGGATGTCTGAAACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-1089s1c1
Sequence:CCGGCCTCGTTATTCTTATGGTGTACTCGAGTACACCATAAGAATAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-1036s1c1
Sequence:CCGGGTGTCTAAGAAAGTCACCCTTCTCGAGAAGGGTGACTTTCTTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152737.3-1359s21c1
Sequence:CCGGGATTAGTATCCATGACATTAACTCGAGTTAATGTCATGGATACTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-666s21c1
Sequence:CCGGTCTACAAGATCATAGACTTTGCTCGAGCAAAGTCTATGATCTTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-1085s21c1
Sequence:CCGGTTGCTAGGTTTGCTCTACTTCCTCGAGGAAGTAGAGCAAACCTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-588s21c1
Sequence:CCGGTCTGTTACAATCGATACAATCCTCGAGGATTGTATCGATTGTAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152737.3-1589s21c1
Sequence:CCGGATGGATCCCTCCTTTCGTATTCTCGAGAATACGAAAGGAGGGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-1112s21c1
Sequence:CCGGTTACCCTTAGGAATCTACTTACTCGAGTAAGTAGATTCCTAAGGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152737
VALIDATED
RNF182 MISSION shRNA shRNA Plasmid DNA
ring finger protein 182
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-667s1c1
Sequence:CCGGCCCGATGACAACAACATCCTTCTCGAGAAGGATGTTGTTGTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152737.1-533s1c1
Sequence:CCGGTGGAGTGTTGTCATAGGGTTTCTCGAGAAACCCTATGACAACACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-948s1c1
Sequence:CCGGCCTGCTGTTTCAGACATCCATCTCGAGATGGATGTCTGAAACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-1089s1c1
Sequence:CCGGCCTCGTTATTCTTATGGTGTACTCGAGTACACCATAAGAATAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-1036s1c1
Sequence:CCGGGTGTCTAAGAAAGTCACCCTTCTCGAGAAGGGTGACTTTCTTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152737.3-1359s21c1
Sequence:CCGGGATTAGTATCCATGACATTAACTCGAGTTAATGTCATGGATACTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-666s21c1
Sequence:CCGGTCTACAAGATCATAGACTTTGCTCGAGCAAAGTCTATGATCTTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-1085s21c1
Sequence:CCGGTTGCTAGGTTTGCTCTACTTCCTCGAGGAAGTAGAGCAAACCTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-588s21c1
Sequence:CCGGTCTGTTACAATCGATACAATCCTCGAGGATTGTATCGATTGTAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152737.3-1589s21c1
Sequence:CCGGATGGATCCCTCCTTTCGTATTCTCGAGAATACGAAAGGAGGGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-1112s21c1
Sequence:CCGGTTACCCTTAGGAATCTACTTACTCGAGTAAGTAGATTCCTAAGGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152737
VALIDATED
RNF182 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 182
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-667s1c1
Sequence:CCGGCCCGATGACAACAACATCCTTCTCGAGAAGGATGTTGTTGTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152737.1-533s1c1
Sequence:CCGGTGGAGTGTTGTCATAGGGTTTCTCGAGAAACCCTATGACAACACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-948s1c1
Sequence:CCGGCCTGCTGTTTCAGACATCCATCTCGAGATGGATGTCTGAAACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-1089s1c1
Sequence:CCGGCCTCGTTATTCTTATGGTGTACTCGAGTACACCATAAGAATAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152737.1-1036s1c1
Sequence:CCGGGTGTCTAAGAAAGTCACCCTTCTCGAGAAGGGTGACTTTCTTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152737.3-1359s21c1
Sequence:CCGGGATTAGTATCCATGACATTAACTCGAGTTAATGTCATGGATACTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-666s21c1
Sequence:CCGGTCTACAAGATCATAGACTTTGCTCGAGCAAAGTCTATGATCTTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-1085s21c1
Sequence:CCGGTTGCTAGGTTTGCTCTACTTCCTCGAGGAAGTAGAGCAAACCTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-588s21c1
Sequence:CCGGTCTGTTACAATCGATACAATCCTCGAGGATTGTATCGATTGTAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152737.3-1589s21c1
Sequence:CCGGATGGATCCCTCCTTTCGTATTCTCGAGAATACGAAAGGAGGGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152737.3-1112s21c1
Sequence:CCGGTTACCCTTAGGAATCTACTTACTCGAGTAAGTAGATTCCTAAGGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183204
RNF182 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 182
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-444s1c1
Sequence:CCGGCTCTACAAGATCATAGACTTTCTCGAGAAAGTCTATGATCTTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-673s1c1
Sequence:CCGGCGTCCTCTAATTGCTTGGTTACTCGAGTAACCAAGCAATTAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-863s1c1
Sequence:CCGGGCTGCTAGGTTTGCTGTACTTCTCGAGAAGTACAGCAAACCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183204.1-1058s1c1
Sequence:CCGGCATAGGAAACTCAGCGCATATCTCGAGATATGCGCTGAGTTTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-353s1c1
Sequence:CCGGGCTCGAGTGTAAGATCTGTTACTCGAGTAACAGATCTTACACTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183204.3-890s21c1
Sequence:CCGGTGCCCTTAGGGATCTACTTACCTCGAGGTAAGTAGATCCCTAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183204
RNF182 MISSION shRNA shRNA Plasmid DNA
ring finger protein 182
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-444s1c1
Sequence:CCGGCTCTACAAGATCATAGACTTTCTCGAGAAAGTCTATGATCTTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-673s1c1
Sequence:CCGGCGTCCTCTAATTGCTTGGTTACTCGAGTAACCAAGCAATTAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-863s1c1
Sequence:CCGGGCTGCTAGGTTTGCTGTACTTCTCGAGAAGTACAGCAAACCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183204.1-1058s1c1
Sequence:CCGGCATAGGAAACTCAGCGCATATCTCGAGATATGCGCTGAGTTTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-353s1c1
Sequence:CCGGGCTCGAGTGTAAGATCTGTTACTCGAGTAACAGATCTTACACTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183204.3-890s21c1
Sequence:CCGGTGCCCTTAGGGATCTACTTACCTCGAGGTAAGTAGATCCCTAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183204
RNF182 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 182
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-444s1c1
Sequence:CCGGCTCTACAAGATCATAGACTTTCTCGAGAAAGTCTATGATCTTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-673s1c1
Sequence:CCGGCGTCCTCTAATTGCTTGGTTACTCGAGTAACCAAGCAATTAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-863s1c1
Sequence:CCGGGCTGCTAGGTTTGCTGTACTTCTCGAGAAGTACAGCAAACCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183204.1-1058s1c1
Sequence:CCGGCATAGGAAACTCAGCGCATATCTCGAGATATGCGCTGAGTTTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183204.1-353s1c1
Sequence:CCGGGCTCGAGTGTAAGATCTGTTACTCGAGTAACAGATCTTACACTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183204.3-890s21c1
Sequence:CCGGTGCCCTTAGGGATCTACTTACCTCGAGGTAAGTAGATCCCTAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks