EMAIL THIS PAGE TO A FRIEND

RNF183

ring finger protein 183

UniProtKB ID: Q96D59
Gene ID:
Mouse(76072) ring finger protein 183
Rat(500474) ring finger protein 183
Zebrafish(767730) ring finger protein 183
domestic cat(101096179) ring finger protein 183
dog(100684892) ring finger protein 183
domestic guinea pig(100722232) ring finger protein 183
naked mole-rat(101703970) ring finger protein 183
cow(539200) ring finger protein 183
sheep(101107329) ring finger protein 183
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145051 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145051 Rosetta Predictions human pricing
XM_001063645 Rosetta Predictions rat pricing
XM_575838 Rosetta Predictions rat pricing
NM_153504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131347 predicted 208
2 SASI_Hs01_00131348 predicted 392
3 SASI_Hs02_00364932 predicted 215
4 SASI_Hs01_00131351 predicted 205
5 SASI_Hs01_00131352 predicted 318
6 SASI_Hs01_00131353 predicted 571
7 SASI_Hs01_00131354 predicted 528
8 SASI_Hs01_00131355 predicted 613
9 SASI_Hs02_00364933 predicted 528
10 SASI_Hs02_00364934 predicted 449
11 SASI_Hs01_00131349 predicted 560
12 SASI_Hs01_00131350 predicted 604
13 SASI_Hs01_00131356 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307898 predicted 992
2 SASI_Rn02_00307899 predicted 1065
3 SASI_Rn02_00307900 predicted 1021
4 SASI_Rn02_00307901 predicted 892
5 SASI_Rn02_00307902 predicted 723
6 SASI_Rn02_00307903 predicted 689
7 SASI_Rn02_00307904 predicted 878
8 SASI_Rn02_00307905 predicted 812
9 SASI_Rn02_00307906 predicted 458
10 SASI_Rn02_00307907 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404414 predicted 997
2 SASI_Rn02_00404415 predicted 1065
3 SASI_Rn02_00404416 predicted 1020
4 SASI_Rn02_00404417 predicted 893
5 SASI_Rn02_00404418 predicted 722
6 SASI_Rn02_00404419 predicted 690
7 SASI_Rn02_00404420 predicted 878
8 SASI_Rn02_00404421 predicted 817
9 SASI_Rn02_00404422 predicted 458
10 SASI_Rn02_00404423 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066247 predicted 425
2 SASI_Mm01_00066248 predicted 1165
3 SASI_Mm02_00343245 predicted 815
4 SASI_Mm01_00066249 predicted 468
5 SASI_Mm01_00066250 predicted 1012
6 SASI_Mm01_00066251 predicted 480
7 SASI_Mm01_00066252 predicted 428
8 SASI_Mm01_00066253 predicted 1086
9 SASI_Mm01_00066254 predicted 585
10 SASI_Mm01_00066255 predicted 849
11 SASI_Mm01_00066256 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145051
RNF183 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 183
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145051.3-586s21c1
Sequence:CCGGCAACCCTCAGTTCCGCATCTTCTCGAGAAGATGCGGAACTGAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145051.3-695s21c1
Sequence:CCGGTGAGTGCTGTTCCCAGACAAGCTCGAGCTTGTCTGGGAACAGCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145051.3-813s21c1
Sequence:CCGGATTGTTCAGGCCATGTGTTTGCTCGAGCAAACACATGGCCTGAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145051.3-748s21c1
Sequence:CCGGGGTGACTACGGAGCCTCATTTCTCGAGAAATGAGGCTCCGTAGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-458s1c1
Sequence:CCGGCGAGTCTACACGCTGGACCTTCTCGAGAAGGTCCAGCGTGTAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-173s1c1
Sequence:CCGGCCCTTCAACAACACGTTCCATCTCGAGATGGAACGTGTTGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-643s1c1
Sequence:CCGGGTTGCTCATATTCTCCATCTTCTCGAGAAGATGGAGAATATGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-562s1c1
Sequence:CCGGCCACTCTTTGAGGGAGTGTTTCTCGAGAAACACTCCCTCAAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145051.2-1014s1c1
Sequence:CCGGCCCAAATAGCAAGTTGCATTTCTCGAGAAATGCAACTTGCTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145051
RNF183 MISSION shRNA shRNA Plasmid DNA
ring finger protein 183
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145051.3-586s21c1
Sequence:CCGGCAACCCTCAGTTCCGCATCTTCTCGAGAAGATGCGGAACTGAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145051.3-695s21c1
Sequence:CCGGTGAGTGCTGTTCCCAGACAAGCTCGAGCTTGTCTGGGAACAGCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145051.3-813s21c1
Sequence:CCGGATTGTTCAGGCCATGTGTTTGCTCGAGCAAACACATGGCCTGAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145051.3-748s21c1
Sequence:CCGGGGTGACTACGGAGCCTCATTTCTCGAGAAATGAGGCTCCGTAGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-458s1c1
Sequence:CCGGCGAGTCTACACGCTGGACCTTCTCGAGAAGGTCCAGCGTGTAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-173s1c1
Sequence:CCGGCCCTTCAACAACACGTTCCATCTCGAGATGGAACGTGTTGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-643s1c1
Sequence:CCGGGTTGCTCATATTCTCCATCTTCTCGAGAAGATGGAGAATATGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-562s1c1
Sequence:CCGGCCACTCTTTGAGGGAGTGTTTCTCGAGAAACACTCCCTCAAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145051.2-1014s1c1
Sequence:CCGGCCCAAATAGCAAGTTGCATTTCTCGAGAAATGCAACTTGCTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145051
RNF183 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 183
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145051.3-586s21c1
Sequence:CCGGCAACCCTCAGTTCCGCATCTTCTCGAGAAGATGCGGAACTGAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145051.3-695s21c1
Sequence:CCGGTGAGTGCTGTTCCCAGACAAGCTCGAGCTTGTCTGGGAACAGCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145051.3-813s21c1
Sequence:CCGGATTGTTCAGGCCATGTGTTTGCTCGAGCAAACACATGGCCTGAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145051.3-748s21c1
Sequence:CCGGGGTGACTACGGAGCCTCATTTCTCGAGAAATGAGGCTCCGTAGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-458s1c1
Sequence:CCGGCGAGTCTACACGCTGGACCTTCTCGAGAAGGTCCAGCGTGTAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-173s1c1
Sequence:CCGGCCCTTCAACAACACGTTCCATCTCGAGATGGAACGTGTTGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-643s1c1
Sequence:CCGGGTTGCTCATATTCTCCATCTTCTCGAGAAGATGGAGAATATGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145051.2-562s1c1
Sequence:CCGGCCACTCTTTGAGGGAGTGTTTCTCGAGAAACACTCCCTCAAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145051.2-1014s1c1
Sequence:CCGGCCCAAATAGCAAGTTGCATTTCTCGAGAAATGCAACTTGCTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153504
VALIDATED
RNF183 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 183
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-485s21c1
Sequence:CCGGTCACTCCTTCTGTGTGGAATGCTCGAGCATTCCACACAGAAGGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-594s21c1
Sequence:CCGGCCAGTCACTGACTTGCCTACACTCGAGTGTAGGCAAGTCAGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-437s21c1
Sequence:CCGGGAACCCTTTCAACAACACATTCTCGAGAATGTGTTGTTGAAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-869s21c3
Sequence:CCGGCGCCTATCTGATGGCTGTCATCTCGAGATGACAGCCATCAGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-1013s21c1
Sequence:CCGGGAGGACTATTGCGAATCCTTTCTCGAGAAAGGATTCGCAATAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153504.2-1014s1c1
Sequence:CCGGGAGGACTATTGCGAATCCTTTCTCGAGAAAGGATTCGCAATAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153504.2-861s1c1
Sequence:CCGGCCGGATCTTCGCCTATCTGATCTCGAGATCAGATAGGCGAAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153504.2-870s1c1
Sequence:CCGGCGCCTATCTGATGGCTGTCATCTCGAGATGACAGCCATCAGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153504.2-438s1c1
Sequence:CCGGGAACCCTTTCAACAACACATTCTCGAGAATGTGTTGTTGAAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153504
VALIDATED
RNF183 MISSION shRNA shRNA Plasmid DNA
ring finger protein 183
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-485s21c1
Sequence:CCGGTCACTCCTTCTGTGTGGAATGCTCGAGCATTCCACACAGAAGGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-594s21c1
Sequence:CCGGCCAGTCACTGACTTGCCTACACTCGAGTGTAGGCAAGTCAGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-437s21c1
Sequence:CCGGGAACCCTTTCAACAACACATTCTCGAGAATGTGTTGTTGAAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-869s21c3
Sequence:CCGGCGCCTATCTGATGGCTGTCATCTCGAGATGACAGCCATCAGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-1013s21c1
Sequence:CCGGGAGGACTATTGCGAATCCTTTCTCGAGAAAGGATTCGCAATAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153504.2-1014s1c1
Sequence:CCGGGAGGACTATTGCGAATCCTTTCTCGAGAAAGGATTCGCAATAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153504.2-861s1c1
Sequence:CCGGCCGGATCTTCGCCTATCTGATCTCGAGATCAGATAGGCGAAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153504.2-870s1c1
Sequence:CCGGCGCCTATCTGATGGCTGTCATCTCGAGATGACAGCCATCAGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153504.2-438s1c1
Sequence:CCGGGAACCCTTTCAACAACACATTCTCGAGAATGTGTTGTTGAAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153504
VALIDATED
RNF183 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 183
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-485s21c1
Sequence:CCGGTCACTCCTTCTGTGTGGAATGCTCGAGCATTCCACACAGAAGGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-594s21c1
Sequence:CCGGCCAGTCACTGACTTGCCTACACTCGAGTGTAGGCAAGTCAGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-437s21c1
Sequence:CCGGGAACCCTTTCAACAACACATTCTCGAGAATGTGTTGTTGAAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-869s21c3
Sequence:CCGGCGCCTATCTGATGGCTGTCATCTCGAGATGACAGCCATCAGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153504.3-1013s21c1
Sequence:CCGGGAGGACTATTGCGAATCCTTTCTCGAGAAAGGATTCGCAATAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153504.2-1014s1c1
Sequence:CCGGGAGGACTATTGCGAATCCTTTCTCGAGAAAGGATTCGCAATAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153504.2-861s1c1
Sequence:CCGGCCGGATCTTCGCCTATCTGATCTCGAGATCAGATAGGCGAAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153504.2-870s1c1
Sequence:CCGGCGCCTATCTGATGGCTGTCATCTCGAGATGACAGCCATCAGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153504.2-438s1c1
Sequence:CCGGGAACCCTTTCAACAACACATTCTCGAGAATGTGTTGTTGAAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks