EMAIL THIS PAGE TO A FRIEND

RNF220

ring finger protein 220

Synonyms: C1orf164
UniProtKB ID: Q5VTB9, B3KPJ3, Q4KMX2, Q9NVP6
Gene ID:
Mouse(66743) ring finger protein 220
Rat(500532) ring finger protein 220
chicken(424580) ring finger protein 220
Horse(100052861) ring finger protein 220
domestic cat(101086665) ring finger protein 220
dog(612846) ring finger protein 220
cow(616005) ring finger protein 220
sheep(101116437) ring finger protein 220
naked mole-rat(101698262) ring finger protein 220
Domestic Rabbit(100350172) ring finger protein 220
domestic guinea pig(100721371) ring finger protein 220
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018150 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087391 MISSION® esiRNA esiRNA human RNF220 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018150 Rosetta Predictions human pricing
XR_006877 Rosetta Predictions rat pricing
XR_008784 Rosetta Predictions rat pricing
NM_025739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118886 predicted 1244
2 SASI_Hs01_00118887 predicted 677
3 SASI_Hs01_00118888 predicted 560
4 SASI_Hs01_00118890 predicted 1519
5 SASI_Hs02_00351384 predicted 528
6 SASI_Hs01_00118891 predicted 1776
7 SASI_Hs01_00118893 predicted 760
8 SASI_Hs01_00118894 predicted 923
9 SASI_Hs01_00118895 predicted 1506
10 SASI_Hs02_00351385 predicted 1566
11 SASI_Hs01_00118889 predicted 970
12 SASI_Hs01_00118892 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169837 predicted 672
2 SASI_Rn01_00169838 predicted 769
3 SASI_Rn02_00413069 predicted 2593
4 SASI_Rn01_00169840 predicted 1679
5 SASI_Rn01_00169841 predicted 2635
6 SASI_Rn01_00169842 predicted 830
7 SASI_Rn01_00169843 predicted 1977
8 SASI_Rn01_00169844 predicted 545
9 SASI_Rn01_00169845 predicted 2036
10 SASI_Rn01_00169846 predicted 1796
11 SASI_Rn01_00169839 predicted 2592
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139449 predicted 671
2 SASI_Rn01_00139450 predicted 770
3 SASI_Rn02_00417908 predicted 2590
4 SASI_Rn01_00139452 predicted 1675
5 SASI_Rn01_00139453 predicted 2635
6 SASI_Rn01_00139454 predicted 832
7 SASI_Rn01_00139455 predicted 1979
8 SASI_Rn01_00139456 predicted 538
9 SASI_Rn01_00139457 predicted 2040
10 SASI_Rn01_00139458 predicted 1800
11 SASI_Rn01_00139451 predicted 2592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115140 predicted 766
2 SASI_Mm01_00115141 predicted 752
3 SASI_Mm01_00115142 predicted 1799
4 SASI_Mm01_00115143 predicted 1052
5 SASI_Mm01_00115144 predicted 773
6 SASI_Mm01_00115145 predicted 1769
7 SASI_Mm01_00115146 predicted 486
8 SASI_Mm01_00115147 predicted 869
9 SASI_Mm01_00115148 predicted 1169
10 SASI_Mm01_00115149 predicted 766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025739
RNF220 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 220
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-1771s21c1
Sequence:CCGGCCTGCAAGAACAGCGACATTGCTCGAGCAATGTCGCTGTTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025739.2-2358s21c1
Sequence:CCGGAGACTGAAGCACATGTAATATCTCGAGATATTACATGTGCTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-1556s21c1
Sequence:CCGGGGAGTATGGGAAACCACAATACTCGAGTATTGTGGTTTCCCATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025739.2-2573s21c1
Sequence:CCGGTCGGTGTTCAGTGGTGTATATCTCGAGATATACACCACTGAACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-2029s21c1
Sequence:CCGGACCTGCGGAGGATCTACTTATCTCGAGATAAGTAGATCCTCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-892s21c1
Sequence:CCGGATACTGGGAAGAAGATCTTTGCTCGAGCAAAGATCTTCTTCCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-1049s21c1
Sequence:CCGGCAGCGAGTTGCAGGAACATATCTCGAGATATGTTCCTGCAACTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-874s1c1
Sequence:CCGGGCTCACTTAAGGTTGATGATACTCGAGTATCATCAACCTTAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-1241s1c1
Sequence:CCGGCTCAGACAGATACCAGACCTTCTCGAGAAGGTCTGGTATCTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-558s1c1
Sequence:CCGGGCCTCTATGTACCACCGGCAACTCGAGTTGCCGGTGGTACATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-738s1c1
Sequence:CCGGGAGAGCTATCAGTCTGCCTTTCTCGAGAAAGGCAGACTGATAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-1770s1c1
Sequence:CCGGACCTGCAAGAACAGCGACATTCTCGAGAATGTCGCTGTTCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025739
RNF220 MISSION shRNA shRNA Plasmid DNA
ring finger protein 220
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-1771s21c1
Sequence:CCGGCCTGCAAGAACAGCGACATTGCTCGAGCAATGTCGCTGTTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025739.2-2358s21c1
Sequence:CCGGAGACTGAAGCACATGTAATATCTCGAGATATTACATGTGCTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-1556s21c1
Sequence:CCGGGGAGTATGGGAAACCACAATACTCGAGTATTGTGGTTTCCCATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025739.2-2573s21c1
Sequence:CCGGTCGGTGTTCAGTGGTGTATATCTCGAGATATACACCACTGAACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-2029s21c1
Sequence:CCGGACCTGCGGAGGATCTACTTATCTCGAGATAAGTAGATCCTCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-892s21c1
Sequence:CCGGATACTGGGAAGAAGATCTTTGCTCGAGCAAAGATCTTCTTCCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-1049s21c1
Sequence:CCGGCAGCGAGTTGCAGGAACATATCTCGAGATATGTTCCTGCAACTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-874s1c1
Sequence:CCGGGCTCACTTAAGGTTGATGATACTCGAGTATCATCAACCTTAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-1241s1c1
Sequence:CCGGCTCAGACAGATACCAGACCTTCTCGAGAAGGTCTGGTATCTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-558s1c1
Sequence:CCGGGCCTCTATGTACCACCGGCAACTCGAGTTGCCGGTGGTACATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-738s1c1
Sequence:CCGGGAGAGCTATCAGTCTGCCTTTCTCGAGAAAGGCAGACTGATAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-1770s1c1
Sequence:CCGGACCTGCAAGAACAGCGACATTCTCGAGAATGTCGCTGTTCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025739
RNF220 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 220
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-1771s21c1
Sequence:CCGGCCTGCAAGAACAGCGACATTGCTCGAGCAATGTCGCTGTTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025739.2-2358s21c1
Sequence:CCGGAGACTGAAGCACATGTAATATCTCGAGATATTACATGTGCTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-1556s21c1
Sequence:CCGGGGAGTATGGGAAACCACAATACTCGAGTATTGTGGTTTCCCATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025739.2-2573s21c1
Sequence:CCGGTCGGTGTTCAGTGGTGTATATCTCGAGATATACACCACTGAACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-2029s21c1
Sequence:CCGGACCTGCGGAGGATCTACTTATCTCGAGATAAGTAGATCCTCCGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-892s21c1
Sequence:CCGGATACTGGGAAGAAGATCTTTGCTCGAGCAAAGATCTTCTTCCCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025739.2-1049s21c1
Sequence:CCGGCAGCGAGTTGCAGGAACATATCTCGAGATATGTTCCTGCAACTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-874s1c1
Sequence:CCGGGCTCACTTAAGGTTGATGATACTCGAGTATCATCAACCTTAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-1241s1c1
Sequence:CCGGCTCAGACAGATACCAGACCTTCTCGAGAAGGTCTGGTATCTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-558s1c1
Sequence:CCGGGCCTCTATGTACCACCGGCAACTCGAGTTGCCGGTGGTACATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-738s1c1
Sequence:CCGGGAGAGCTATCAGTCTGCCTTTCTCGAGAAAGGCAGACTGATAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025739.2-1770s1c1
Sequence:CCGGACCTGCAAGAACAGCGACATTCTCGAGAATGTCGCTGTTCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018150
VALIDATED
RNF220 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 220
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018150.2-636s21c1
Sequence:CCGGACTACACCTCCACCCTCAATTCTCGAGAATTGAGGGTGGAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018150.2-750s21c1
Sequence:CCGGGAGCTATCAGTCAGCCTTTACCTCGAGGTAAAGGCTGACTGATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018150.2-2645s21c1
Sequence:CCGGCGGTGTTCAGTGGTGTATATTCTCGAGAATATACACCACTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018150.2-970s21c1
Sequence:CCGGGATCGGAATGACAGATGTAAGCTCGAGCTTACATCTGTCATTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018150.2-2192s21c1
Sequence:CCGGGCGTACACACACACACATTTACTCGAGTAAATGTGTGTGTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-1398s1c1
Sequence:CCGGGCATGAGAACAACAACCGCTTCTCGAGAAGCGGTTGTTGTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161933    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018150.2-2192s1c1
Sequence:CCGGGCGTACACACACACACATTTACTCGAGTAAATGTGTGTGTGTGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-839s1c1
Sequence:CCGGGCAAGGAATATGACTTTGGGACTCGAGTCCCAAAGTCATATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-682s1c1
Sequence:CCGGCCAATCAGTATGCTGAATCATCTCGAGATGATTCAGCATACTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018150.2-2645s1c1
Sequence:CCGGCGGTGTTCAGTGGTGTATATTCTCGAGAATATACACCACTGAACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-554s1c1
Sequence:CCGGGTTCCTATACCTTTGCCTCTACTCGAGTAGAGGCAAAGGTATAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-882s1c1
Sequence:CCGGCGGTTCACTAAAGGTTGATGACTCGAGTCATCAACCTTTAGTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018150.2-1579s1c1
Sequence:CCGGCCACAATACACAGAGGCTGATCTCGAGATCAGCCTCTGTGTATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-531s1c1
Sequence:CCGGCGTGCATATTCCTTTCACCAACTCGAGTTGGTGAAAGGAATATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018150
VALIDATED
RNF220 MISSION shRNA shRNA Plasmid DNA
ring finger protein 220
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018150.2-636s21c1
Sequence:CCGGACTACACCTCCACCCTCAATTCTCGAGAATTGAGGGTGGAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018150.2-750s21c1
Sequence:CCGGGAGCTATCAGTCAGCCTTTACCTCGAGGTAAAGGCTGACTGATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018150.2-2645s21c1
Sequence:CCGGCGGTGTTCAGTGGTGTATATTCTCGAGAATATACACCACTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018150.2-970s21c1
Sequence:CCGGGATCGGAATGACAGATGTAAGCTCGAGCTTACATCTGTCATTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018150.2-2192s21c1
Sequence:CCGGGCGTACACACACACACATTTACTCGAGTAAATGTGTGTGTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-1398s1c1
Sequence:CCGGGCATGAGAACAACAACCGCTTCTCGAGAAGCGGTTGTTGTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161933    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018150.2-2192s1c1
Sequence:CCGGGCGTACACACACACACATTTACTCGAGTAAATGTGTGTGTGTGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-839s1c1
Sequence:CCGGGCAAGGAATATGACTTTGGGACTCGAGTCCCAAAGTCATATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-682s1c1
Sequence:CCGGCCAATCAGTATGCTGAATCATCTCGAGATGATTCAGCATACTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018150.2-2645s1c1
Sequence:CCGGCGGTGTTCAGTGGTGTATATTCTCGAGAATATACACCACTGAACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-554s1c1
Sequence:CCGGGTTCCTATACCTTTGCCTCTACTCGAGTAGAGGCAAAGGTATAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-882s1c1
Sequence:CCGGCGGTTCACTAAAGGTTGATGACTCGAGTCATCAACCTTTAGTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018150.2-1579s1c1
Sequence:CCGGCCACAATACACAGAGGCTGATCTCGAGATCAGCCTCTGTGTATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-531s1c1
Sequence:CCGGCGTGCATATTCCTTTCACCAACTCGAGTTGGTGAAAGGAATATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018150
VALIDATED
RNF220 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 220
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018150.2-636s21c1
Sequence:CCGGACTACACCTCCACCCTCAATTCTCGAGAATTGAGGGTGGAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018150.2-750s21c1
Sequence:CCGGGAGCTATCAGTCAGCCTTTACCTCGAGGTAAAGGCTGACTGATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018150.2-2645s21c1
Sequence:CCGGCGGTGTTCAGTGGTGTATATTCTCGAGAATATACACCACTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018150.2-970s21c1
Sequence:CCGGGATCGGAATGACAGATGTAAGCTCGAGCTTACATCTGTCATTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018150.2-2192s21c1
Sequence:CCGGGCGTACACACACACACATTTACTCGAGTAAATGTGTGTGTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-1398s1c1
Sequence:CCGGGCATGAGAACAACAACCGCTTCTCGAGAAGCGGTTGTTGTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161933    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018150.2-2192s1c1
Sequence:CCGGGCGTACACACACACACATTTACTCGAGTAAATGTGTGTGTGTGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-839s1c1
Sequence:CCGGGCAAGGAATATGACTTTGGGACTCGAGTCCCAAAGTCATATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-682s1c1
Sequence:CCGGCCAATCAGTATGCTGAATCATCTCGAGATGATTCAGCATACTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160783    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018150.2-2645s1c1
Sequence:CCGGCGGTGTTCAGTGGTGTATATTCTCGAGAATATACACCACTGAACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-554s1c1
Sequence:CCGGGTTCCTATACCTTTGCCTCTACTCGAGTAGAGGCAAAGGTATAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-882s1c1
Sequence:CCGGCGGTTCACTAAAGGTTGATGACTCGAGTCATCAACCTTTAGTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018150.2-1579s1c1
Sequence:CCGGCCACAATACACAGAGGCTGATCTCGAGATCAGCCTCTGTGTATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018150.2-531s1c1
Sequence:CCGGCGTGCATATTCCTTTCACCAACTCGAGTTGGTGAAAGGAATATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks