EMAIL THIS PAGE TO A FRIEND

RNF26

ring finger protein 26

UniProtKB ID: Q9BY78, Q542Y8
Gene ID:
Human(79102) Summary: The protein encoded by this intronless gene contains a C3HC5 type of RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. The expression of this gene was found to be upregulated in cancer cell lines derived from different types of cancer. [provided by RefSeq, Jul 2008]
Mouse(213211) ring finger protein 26
Rat(300659) ring finger protein 26
cow(539611) ring finger protein 26
sheep(101108946) ring finger protein 26
domestic guinea pig(100717945) ring finger protein 26
Zebrafish(793090) ring finger protein 26
dog(489367) ring finger protein 26
domestic cat(101097014) ring finger protein 26
chicken(769803) ring finger protein 26
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032015 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047161 MISSION® esiRNA esiRNA human RNF26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032015 Rosetta Predictions human pricing
NM_001113748 Rosetta Predictions rat pricing
NM_153762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160403 predicted 2028
2 SASI_Hs01_00160405 predicted 2062
3 SASI_Hs02_00359194 predicted 1962
4 SASI_Hs01_00160406 predicted 2337
5 SASI_Hs01_00160407 predicted 2108
6 SASI_Hs01_00160409 predicted 2010
7 SASI_Hs02_00359195 predicted 2061
8 SASI_Hs01_00160412 predicted 2291
9 SASI_Hs02_00359196 predicted 2026
10 SASI_Hs02_00359197 predicted 1876
11 SASI_Hs01_00160404 predicted 1263
12 SASI_Hs01_00160408 predicted 1535
13 SASI_Hs01_00160410 predicted 998
14 SASI_Hs01_00160411 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251943 predicted 1051
2 SASI_Rn02_00251944 predicted 440
3 SASI_Rn02_00251945 predicted 1100
4 SASI_Rn02_00251946 predicted 544
5 SASI_Rn02_00251947 predicted 456
6 SASI_Rn02_00251948 predicted 823
7 SASI_Rn02_00251949 predicted 426
8 SASI_Rn02_00251950 predicted 805
9 SASI_Rn02_00251951 predicted 418
10 SASI_Rn02_00251952 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343476 predicted 652
2 SASI_Mm01_00044576 predicted 1559
3 SASI_Mm01_00044578 predicted 1172
4 SASI_Mm01_00044584 predicted 503
5 SASI_Mm01_00044579 predicted 1610
6 SASI_Mm01_00044580 predicted 1551
7 SASI_Mm01_00044585 predicted 624
8 SASI_Mm02_00343477 predicted 539
9 SASI_Mm02_00343478 predicted 528
10 SASI_Mm02_00343479 predicted 527
11 SASI_Mm01_00044577 predicted 1520
12 SASI_Mm01_00044581 predicted 1357
13 SASI_Mm01_00044582 predicted 921
14 SASI_Mm01_00044583 predicted 1427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032015
VALIDATED
RNF26 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 26
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032015.3-779s1c1
Sequence:CCGGCTTGCTTTCATTGCTGGCCTTCTCGAGAAGGCCAGCAATGAAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-841s1c1
Sequence:CCGGCCTTGTGTACTCTGCTGTATACTCGAGTATACAGCAGAGTACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-1694s1c1
Sequence:CCGGCCCTTGGAAATTGCTGAAGGACTCGAGTCCTTCAGCAATTTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-1257s1c1
Sequence:CCGGGCCAGCTTTGTGCTTGTCAATCTCGAGATTGACAAGCACAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-1022s1c1
Sequence:CCGGCCTGGTGGCTTATGTGATCAACTCGAGTTGATCACATAAGCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032015.3-1200s21c1
Sequence:CCGGCTTTGGACACCCTGCCAACTACTCGAGTAGTTGGCAGGGTGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032015.3-2135s21c1
Sequence:CCGGCAAGGGCCCTGAGACTATTTGCTCGAGCAAATAGTCTCAGGGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032015.3-2333s21c1
Sequence:CCGGGGGCCTTCGGATGATCTTAAACTCGAGTTTAAGATCATCCGAAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032015
VALIDATED
RNF26 MISSION shRNA shRNA Plasmid DNA
ring finger protein 26
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032015.3-779s1c1
Sequence:CCGGCTTGCTTTCATTGCTGGCCTTCTCGAGAAGGCCAGCAATGAAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-841s1c1
Sequence:CCGGCCTTGTGTACTCTGCTGTATACTCGAGTATACAGCAGAGTACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-1694s1c1
Sequence:CCGGCCCTTGGAAATTGCTGAAGGACTCGAGTCCTTCAGCAATTTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-1257s1c1
Sequence:CCGGGCCAGCTTTGTGCTTGTCAATCTCGAGATTGACAAGCACAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-1022s1c1
Sequence:CCGGCCTGGTGGCTTATGTGATCAACTCGAGTTGATCACATAAGCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032015.3-1200s21c1
Sequence:CCGGCTTTGGACACCCTGCCAACTACTCGAGTAGTTGGCAGGGTGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032015.3-2135s21c1
Sequence:CCGGCAAGGGCCCTGAGACTATTTGCTCGAGCAAATAGTCTCAGGGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032015.3-2333s21c1
Sequence:CCGGGGGCCTTCGGATGATCTTAAACTCGAGTTTAAGATCATCCGAAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032015
VALIDATED
RNF26 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 26
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032015.3-779s1c1
Sequence:CCGGCTTGCTTTCATTGCTGGCCTTCTCGAGAAGGCCAGCAATGAAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-841s1c1
Sequence:CCGGCCTTGTGTACTCTGCTGTATACTCGAGTATACAGCAGAGTACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-1694s1c1
Sequence:CCGGCCCTTGGAAATTGCTGAAGGACTCGAGTCCTTCAGCAATTTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-1257s1c1
Sequence:CCGGGCCAGCTTTGTGCTTGTCAATCTCGAGATTGACAAGCACAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032015.3-1022s1c1
Sequence:CCGGCCTGGTGGCTTATGTGATCAACTCGAGTTGATCACATAAGCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032015.3-1200s21c1
Sequence:CCGGCTTTGGACACCCTGCCAACTACTCGAGTAGTTGGCAGGGTGTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032015.3-2135s21c1
Sequence:CCGGCAAGGGCCCTGAGACTATTTGCTCGAGCAAATAGTCTCAGGGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032015.3-2333s21c1
Sequence:CCGGGGGCCTTCGGATGATCTTAAACTCGAGTTTAAGATCATCCGAAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153762
RNF26 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 26
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-1522s1c1
Sequence:CCGGCCACAGGACACTCCTCCTGAACTCGAGTTCAGGAGGAGTGTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153762.2-2585s1c1
Sequence:CCGGGCTGGGAATGTTCTATTCCATCTCGAGATGGAATAGAACATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-1627s1c1
Sequence:CCGGTGGAAGCTGTTGAAGGAGCAACTCGAGTTGCTCCTTCAACAGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-906s1c1
Sequence:CCGGCATCCTGAACATGGTCTCCAACTCGAGTTGGAGACCATGTTCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-1255s1c1
Sequence:CCGGGCTTGCGTGCTGGCAGTGATTCTCGAGAATCACTGCCAGCACGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153762.3-1561s21c1
Sequence:CCGGGAGTAACACTTTCTCTAAATCCTCGAGGATTTAGAGAAAGTGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153762.3-1855s21c1
Sequence:CCGGGGTTTGGATCTTGAACCTTTACTCGAGTAAAGGTTCAAGATCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153762
RNF26 MISSION shRNA shRNA Plasmid DNA
ring finger protein 26
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-1522s1c1
Sequence:CCGGCCACAGGACACTCCTCCTGAACTCGAGTTCAGGAGGAGTGTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153762.2-2585s1c1
Sequence:CCGGGCTGGGAATGTTCTATTCCATCTCGAGATGGAATAGAACATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-1627s1c1
Sequence:CCGGTGGAAGCTGTTGAAGGAGCAACTCGAGTTGCTCCTTCAACAGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-906s1c1
Sequence:CCGGCATCCTGAACATGGTCTCCAACTCGAGTTGGAGACCATGTTCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-1255s1c1
Sequence:CCGGGCTTGCGTGCTGGCAGTGATTCTCGAGAATCACTGCCAGCACGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153762.3-1561s21c1
Sequence:CCGGGAGTAACACTTTCTCTAAATCCTCGAGGATTTAGAGAAAGTGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153762.3-1855s21c1
Sequence:CCGGGGTTTGGATCTTGAACCTTTACTCGAGTAAAGGTTCAAGATCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153762
RNF26 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 26
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-1522s1c1
Sequence:CCGGCCACAGGACACTCCTCCTGAACTCGAGTTCAGGAGGAGTGTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153762.2-2585s1c1
Sequence:CCGGGCTGGGAATGTTCTATTCCATCTCGAGATGGAATAGAACATTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-1627s1c1
Sequence:CCGGTGGAAGCTGTTGAAGGAGCAACTCGAGTTGCTCCTTCAACAGCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-906s1c1
Sequence:CCGGCATCCTGAACATGGTCTCCAACTCGAGTTGGAGACCATGTTCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153762.2-1255s1c1
Sequence:CCGGGCTTGCGTGCTGGCAGTGATTCTCGAGAATCACTGCCAGCACGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153762.3-1561s21c1
Sequence:CCGGGAGTAACACTTTCTCTAAATCCTCGAGGATTTAGAGAAAGTGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153762.3-1855s21c1
Sequence:CCGGGGTTTGGATCTTGAACCTTTACTCGAGTAAAGGTTCAAGATCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks