EMAIL THIS PAGE TO A FRIEND

RNF5

ring finger protein 5, E3 ubiquitin protein ligase

Synonyms: RING5 RMA1
UniProtKB ID: Q99942, A2BFI6, B2R4K3, Q0VDB7, Q9UMQ2
Gene ID:
Human(6048) Summary: The protein encoded by this gene contains a RING finger, which is a motif known to be involved in protein-protein interactions. This protein is a membrane-bound ubiquitin ligase. It can regulate cell motility by targeting paxillin ubiquitination and altering the distribution and localization of paxillin in cytoplasm and cell focal adhesions. [provided by RefSeq, Jul 2008]
Mouse(54197) ring finger protein 5
Rat(407784) ring finger protein 5, E3 ubiquitin protein ligase
dog(474858) ring finger protein 5, E3 ubiquitin protein ligase
domestic cat(101096477) ring finger protein 5, E3 ubiquitin protein ligase
domestic guinea pig(100713396) ring finger protein 5, E3 ubiquitin protein ligase
naked mole-rat(101708759) ring finger protein 5, E3 ubiquitin protein ligase
cow(616187) ring finger protein 5, E3 ubiquitin protein ligase
sheep(101112355) ring finger protein 5, E3 ubiquitin protein ligase
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006913 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006913 siRNAs that have been validated in the lab human pricing
NM_001109025 Rosetta Predictions rat pricing
NM_019403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006913 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132064 validated 857
2 SASI_Hs01_00132065 predicted 845
3 SASI_Hs01_00132066 predicted 604
4 SASI_Hs01_00132068 predicted 827
5 SASI_Hs01_00132069 predicted 485
6 SASI_Hs01_00132070 predicted 344
7 SASI_Hs01_00132071 predicted 658
8 SASI_Hs01_00132072 predicted 297
9 SASI_Hs01_00132073 predicted 851
10 SASI_Hs02_00342590 predicted 453
11 SASI_Hs01_00132067 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244434 predicted 776
2 SASI_Rn02_00244435 predicted 286
3 SASI_Rn02_00244436 predicted 724
4 SASI_Rn02_00244437 predicted 316
5 SASI_Rn02_00244438 predicted 621
6 SASI_Rn02_00244439 predicted 273
7 SASI_Rn02_00244440 predicted 657
8 SASI_Rn02_00244441 predicted 273
9 SASI_Rn02_00244442 predicted 319
10 SASI_Rn02_00244443 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122433 predicted 776
2 SASI_Mm01_00122434 predicted 580
3 SASI_Mm01_00122436 predicted 264
4 SASI_Mm02_00324324 predicted 773
5 SASI_Mm01_00122437 predicted 610
6 SASI_Mm01_00122438 predicted 653
7 SASI_Mm02_00324325 predicted 655
8 SASI_Mm01_00122439 predicted 494
9 SASI_Mm01_00122440 predicted 564
10 SASI_Mm01_00122441 predicted 274
11 SASI_Mm01_00122435 predicted 309
12 SASI_Mm01_00122442 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019403
VALIDATED
RNF5 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 5, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-347s21c1
Sequence:CCGGCCACAGGATCCCAGATTGAAACTCGAGTTTCAATCTGGGATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-494s21c1
Sequence:CCGGACCGTGTTCAATGCCCATGAACTCGAGTTCATGGGCATTGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-155s21c1
Sequence:CCGGGCGACCTTCGAATGTAATATACTCGAGTATATTACATTCGAAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019403.3-945s21c1
Sequence:CCGGCCAACTCCTCTACTTGACTTACTCGAGTAAGTCAAGTAGAGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-280s21c1
Sequence:CCGGCCCGGTGTGTAAAGCTGGCATCTCGAGATGCCAGCTTTACACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019403.2-945s1c1
Sequence:CCGGCCAACTCCTCTACTTGACTTACTCGAGTAAGTCAAGTAGAGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019403.2-494s1c1
Sequence:CCGGACCGTGTTCAATGCCCATGAACTCGAGTTCATGGGCATTGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019403.2-347s1c1
Sequence:CCGGCCACAGGATCCCAGATTGAAACTCGAGTTTCAATCTGGGATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019403.2-280s1c1
Sequence:CCGGCCCGGTGTGTAAAGCTGGCATCTCGAGATGCCAGCTTTACACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019403.2-155s1c1
Sequence:CCGGGCGACCTTCGAATGTAATATACTCGAGTATATTACATTCGAAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019403
VALIDATED
RNF5 MISSION shRNA shRNA Plasmid DNA
ring finger protein 5, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-347s21c1
Sequence:CCGGCCACAGGATCCCAGATTGAAACTCGAGTTTCAATCTGGGATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-494s21c1
Sequence:CCGGACCGTGTTCAATGCCCATGAACTCGAGTTCATGGGCATTGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-155s21c1
Sequence:CCGGGCGACCTTCGAATGTAATATACTCGAGTATATTACATTCGAAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019403.3-945s21c1
Sequence:CCGGCCAACTCCTCTACTTGACTTACTCGAGTAAGTCAAGTAGAGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-280s21c1
Sequence:CCGGCCCGGTGTGTAAAGCTGGCATCTCGAGATGCCAGCTTTACACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019403.2-945s1c1
Sequence:CCGGCCAACTCCTCTACTTGACTTACTCGAGTAAGTCAAGTAGAGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019403.2-494s1c1
Sequence:CCGGACCGTGTTCAATGCCCATGAACTCGAGTTCATGGGCATTGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019403.2-347s1c1
Sequence:CCGGCCACAGGATCCCAGATTGAAACTCGAGTTTCAATCTGGGATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019403.2-280s1c1
Sequence:CCGGCCCGGTGTGTAAAGCTGGCATCTCGAGATGCCAGCTTTACACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019403.2-155s1c1
Sequence:CCGGGCGACCTTCGAATGTAATATACTCGAGTATATTACATTCGAAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019403
VALIDATED
RNF5 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 5, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-347s21c1
Sequence:CCGGCCACAGGATCCCAGATTGAAACTCGAGTTTCAATCTGGGATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-494s21c1
Sequence:CCGGACCGTGTTCAATGCCCATGAACTCGAGTTCATGGGCATTGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-155s21c1
Sequence:CCGGGCGACCTTCGAATGTAATATACTCGAGTATATTACATTCGAAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019403.3-945s21c1
Sequence:CCGGCCAACTCCTCTACTTGACTTACTCGAGTAAGTCAAGTAGAGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019403.3-280s21c1
Sequence:CCGGCCCGGTGTGTAAAGCTGGCATCTCGAGATGCCAGCTTTACACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019403.2-945s1c1
Sequence:CCGGCCAACTCCTCTACTTGACTTACTCGAGTAAGTCAAGTAGAGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019403.2-494s1c1
Sequence:CCGGACCGTGTTCAATGCCCATGAACTCGAGTTCATGGGCATTGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019403.2-347s1c1
Sequence:CCGGCCACAGGATCCCAGATTGAAACTCGAGTTTCAATCTGGGATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019403.2-280s1c1
Sequence:CCGGCCCGGTGTGTAAAGCTGGCATCTCGAGATGCCAGCTTTACACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019403.2-155s1c1
Sequence:CCGGGCGACCTTCGAATGTAATATACTCGAGTATATTACATTCGAAGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006913
VALIDATED
RNF5 MISSION shRNA Bacterial Glycerol Stock
ring finger protein 5, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-195s21c1
Sequence:CCGGCGACCTTCGAATGTAATATATCTCGAGATATATTACATTCGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-308s21c1
Sequence:CCGGCGGCAAGAGTGTCCAGTATGTCTCGAGACATACTGGACACTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006913.3-457s21c1
Sequence:CCGGATTCCAGCCATTTGGTGATACCTCGAGGTATCACCAAATGGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-338s21c1
Sequence:CCGGATCAGCAGAGAGAAGGTTGTCCTCGAGGACAACCTTCTCTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-865s21c1
Sequence:CCGGCTCACTCAGTAACGTTGTTTACTCGAGTAAACAACGTTACTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-320s1c1
Sequence:CCGGGAACGGCAAGAGTGTCCAGTACTCGAGTACTGGACACTCTTGCCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-323s1c1
Sequence:CCGGCGGCAAGAGTGTCCAGTATGTCTCGAGACATACTGGACACTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-329s1c1
Sequence:CCGGGAGTGTCCAGTATGTAAAGCTCTCGAGAGCTTTACATACTGGACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004787    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_006913.2-337s1c1
Sequence:CCGGAGTATGTAAAGCTGGGATCAGCTCGAGCTGATCCCAGCTTTACATACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004786    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-353s1c1
Sequence:CCGGATCAGCAGAGAGAAGGTTGTCCTCGAGGACAACCTTCTCTCTGCTGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006913
VALIDATED
RNF5 MISSION shRNA shRNA Plasmid DNA
ring finger protein 5, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-195s21c1
Sequence:CCGGCGACCTTCGAATGTAATATATCTCGAGATATATTACATTCGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-308s21c1
Sequence:CCGGCGGCAAGAGTGTCCAGTATGTCTCGAGACATACTGGACACTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006913.3-457s21c1
Sequence:CCGGATTCCAGCCATTTGGTGATACCTCGAGGTATCACCAAATGGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-338s21c1
Sequence:CCGGATCAGCAGAGAGAAGGTTGTCCTCGAGGACAACCTTCTCTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-865s21c1
Sequence:CCGGCTCACTCAGTAACGTTGTTTACTCGAGTAAACAACGTTACTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-320s1c1
Sequence:CCGGGAACGGCAAGAGTGTCCAGTACTCGAGTACTGGACACTCTTGCCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-323s1c1
Sequence:CCGGCGGCAAGAGTGTCCAGTATGTCTCGAGACATACTGGACACTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-329s1c1
Sequence:CCGGGAGTGTCCAGTATGTAAAGCTCTCGAGAGCTTTACATACTGGACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004787    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_006913.2-337s1c1
Sequence:CCGGAGTATGTAAAGCTGGGATCAGCTCGAGCTGATCCCAGCTTTACATACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004786    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-353s1c1
Sequence:CCGGATCAGCAGAGAGAAGGTTGTCCTCGAGGACAACCTTCTCTCTGCTGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006913
VALIDATED
RNF5 MISSION shRNA Lentiviral Transduction Particles
ring finger protein 5, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-195s21c1
Sequence:CCGGCGACCTTCGAATGTAATATATCTCGAGATATATTACATTCGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-308s21c1
Sequence:CCGGCGGCAAGAGTGTCCAGTATGTCTCGAGACATACTGGACACTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006913.3-457s21c1
Sequence:CCGGATTCCAGCCATTTGGTGATACCTCGAGGTATCACCAAATGGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-338s21c1
Sequence:CCGGATCAGCAGAGAGAAGGTTGTCCTCGAGGACAACCTTCTCTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006913.3-865s21c1
Sequence:CCGGCTCACTCAGTAACGTTGTTTACTCGAGTAAACAACGTTACTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-320s1c1
Sequence:CCGGGAACGGCAAGAGTGTCCAGTACTCGAGTACTGGACACTCTTGCCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-323s1c1
Sequence:CCGGCGGCAAGAGTGTCCAGTATGTCTCGAGACATACTGGACACTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-329s1c1
Sequence:CCGGGAGTGTCCAGTATGTAAAGCTCTCGAGAGCTTTACATACTGGACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004787    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_006913.2-337s1c1
Sequence:CCGGAGTATGTAAAGCTGGGATCAGCTCGAGCTGATCCCAGCTTTACATACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004786    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006913.2-353s1c1
Sequence:CCGGATCAGCAGAGAGAAGGTTGTCCTCGAGGACAACCTTCTCTCTGCTGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks