EMAIL THIS PAGE TO A FRIEND

RNFT1

ring finger protein, transmembrane 1

UniProtKB ID: Q5M7Z0, Q8N7D0, Q96IZ9, Q9Y686
Gene ID:
Mouse(76892) ring finger protein, transmembrane 1
Rat(360595) ring finger protein, transmembrane 1
domestic guinea pig(100728980) ring finger protein, transmembrane 1
naked mole-rat(101725413) ring finger protein, transmembrane 1
Domestic Rabbit(100351033) ring finger protein, transmembrane 1
cow(616080) ring finger protein, transmembrane 1
sheep(101106782) ring finger protein, transmembrane 1
Zebrafish(406509) ring finger protein, transmembrane 1
Horse(100072218) ring finger protein, transmembrane 1
domestic cat(101092309) ring finger protein, transmembrane 1
dog(480581) ring finger protein, transmembrane 1
chicken(417638) ring finger protein, transmembrane 1
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016125 Rosetta Predictions human pricing
XM_001081135 Rosetta Predictions rat pricing
XM_340875 Rosetta Predictions rat pricing
NM_029788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348904 predicted 1204
2 SASI_Hs02_00348905 predicted 1194
3 SASI_Hs02_00348906 predicted 1073
4 SASI_Hs02_00348907 predicted 1201
5 SASI_Hs02_00348908 predicted 1371
6 SASI_Hs01_00203701 predicted 333
7 SASI_Hs02_00348909 predicted 1070
8 SASI_Hs01_00203704 predicted 508
9 SASI_Hs02_00348910 predicted 339
10 SASI_Hs02_00348911 predicted 708
11 SASI_Hs01_00203695 predicted 500
12 SASI_Hs01_00203696 predicted 486
13 SASI_Hs01_00203697 predicted 821
14 SASI_Hs01_00203698 predicted 695
15 SASI_Hs01_00203699 predicted 452
16 SASI_Hs01_00203700 predicted 595
17 SASI_Hs01_00203702 predicted 563
18 SASI_Hs01_00203703 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370695 predicted 1121
2 SASI_Rn02_00370696 predicted 636
3 SASI_Rn02_00370697 predicted 995
4 SASI_Rn02_00370698 predicted 1205
5 SASI_Rn02_00370699 predicted 1077
6 SASI_Rn02_00370700 predicted 376
7 SASI_Rn02_00370701 predicted 1067
8 SASI_Rn02_00370702 predicted 823
9 SASI_Rn02_00370703 predicted 479
10 SASI_Rn02_00370704 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392050 predicted 1119
2 SASI_Rn02_00392051 predicted 641
3 SASI_Rn02_00392052 predicted 997
4 SASI_Rn02_00392053 predicted 1076
5 SASI_Rn02_00392054 predicted 370
6 SASI_Rn02_00392055 predicted 1067
7 SASI_Rn02_00392056 predicted 822
8 SASI_Rn02_00392057 predicted 480
9 SASI_Rn02_00392058 predicted 836
10 SASI_Rn02_00392059 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124059 predicted 1470
2 SASI_Mm01_00124061 predicted 1263
3 SASI_Mm01_00124062 predicted 1373
4 SASI_Mm02_00335932 predicted 1391
5 SASI_Mm01_00124063 predicted 1175
6 SASI_Mm01_00124064 predicted 1351
7 SASI_Mm01_00124066 predicted 1254
8 SASI_Mm01_00124067 predicted 557
9 SASI_Mm01_00124068 predicted 810
10 SASI_Mm02_00335933 predicted 575
11 SASI_Mm01_00124060 predicted 1318
12 SASI_Mm01_00124065 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016125
VALIDATED
RNFT1 MISSION shRNA Bacterial Glycerol Stock
ring finger protein, transmembrane 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016125.3-1283s21c1
Sequence:CCGGAGTGCATGACCTTATGGTTTACTCGAGTAAACCATAAGGTCATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016125.3-933s21c1
Sequence:CCGGATCTAAGGGTTACTGGTATATCTCGAGATATACCAGTAACCCTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016125.3-1431s21c1
Sequence:CCGGCTAATGTCATTTGGTCATAATCTCGAGATTATGACCAAATGACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-786s1c1
Sequence:CCGGGCCTTCTTTCATCATGCCTTTCTCGAGAAAGGCATGATGAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016125.2-691s1c1
Sequence:CCGGCATTTGAGCTTCTGGGAAGTACTCGAGTACTTCCCAGAAGCTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-571s1c1
Sequence:CCGGTGCAGCATATAACAGGAATTTCTCGAGAAATTCCTGTTATATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-448s1c1
Sequence:CCGGCTGATGATACTGCCGCAGAATCTCGAGATTCTGCGGCAGTATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-314s1c1
Sequence:CCGGCCAGATAAACTCCATACCTAACTCGAGTTAGGTATGGAGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016125
VALIDATED
RNFT1 MISSION shRNA shRNA Plasmid DNA
ring finger protein, transmembrane 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016125.3-1283s21c1
Sequence:CCGGAGTGCATGACCTTATGGTTTACTCGAGTAAACCATAAGGTCATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016125.3-933s21c1
Sequence:CCGGATCTAAGGGTTACTGGTATATCTCGAGATATACCAGTAACCCTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016125.3-1431s21c1
Sequence:CCGGCTAATGTCATTTGGTCATAATCTCGAGATTATGACCAAATGACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-786s1c1
Sequence:CCGGGCCTTCTTTCATCATGCCTTTCTCGAGAAAGGCATGATGAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016125.2-691s1c1
Sequence:CCGGCATTTGAGCTTCTGGGAAGTACTCGAGTACTTCCCAGAAGCTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-571s1c1
Sequence:CCGGTGCAGCATATAACAGGAATTTCTCGAGAAATTCCTGTTATATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-448s1c1
Sequence:CCGGCTGATGATACTGCCGCAGAATCTCGAGATTCTGCGGCAGTATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-314s1c1
Sequence:CCGGCCAGATAAACTCCATACCTAACTCGAGTTAGGTATGGAGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016125
VALIDATED
RNFT1 MISSION shRNA Lentiviral Transduction Particles
ring finger protein, transmembrane 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016125.3-1283s21c1
Sequence:CCGGAGTGCATGACCTTATGGTTTACTCGAGTAAACCATAAGGTCATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016125.3-933s21c1
Sequence:CCGGATCTAAGGGTTACTGGTATATCTCGAGATATACCAGTAACCCTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016125.3-1431s21c1
Sequence:CCGGCTAATGTCATTTGGTCATAATCTCGAGATTATGACCAAATGACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-786s1c1
Sequence:CCGGGCCTTCTTTCATCATGCCTTTCTCGAGAAAGGCATGATGAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016125.2-691s1c1
Sequence:CCGGCATTTGAGCTTCTGGGAAGTACTCGAGTACTTCCCAGAAGCTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-571s1c1
Sequence:CCGGTGCAGCATATAACAGGAATTTCTCGAGAAATTCCTGTTATATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-448s1c1
Sequence:CCGGCTGATGATACTGCCGCAGAATCTCGAGATTCTGCGGCAGTATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016125.2-314s1c1
Sequence:CCGGCCAGATAAACTCCATACCTAACTCGAGTTAGGTATGGAGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029788
RNFT1 MISSION shRNA Bacterial Glycerol Stock
ring finger protein, transmembrane 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000041178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-1053s1c1
Sequence:CCGGGCTGGCTTTACTCTACCTCATCTCGAGATGAGGTAGAGTAAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-722s1c1
Sequence:CCGGCCGTCCTCTTATATTACACTTCTCGAGAAGTGTAATATAAGAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-1176s1c1
Sequence:CCGGGTGTTCAGATATGGATGGTATCTCGAGATACCATCCATATCTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-263s1c1
Sequence:CCGGCGTGTGGTCATTCAAGATCAACTCGAGTTGATCTTGAATGACCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029788
RNFT1 MISSION shRNA shRNA Plasmid DNA
ring finger protein, transmembrane 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000041178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-1053s1c1
Sequence:CCGGGCTGGCTTTACTCTACCTCATCTCGAGATGAGGTAGAGTAAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-722s1c1
Sequence:CCGGCCGTCCTCTTATATTACACTTCTCGAGAAGTGTAATATAAGAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-1176s1c1
Sequence:CCGGGTGTTCAGATATGGATGGTATCTCGAGATACCATCCATATCTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-263s1c1
Sequence:CCGGCGTGTGGTCATTCAAGATCAACTCGAGTTGATCTTGAATGACCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029788
RNFT1 MISSION shRNA Lentiviral Transduction Particles
ring finger protein, transmembrane 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000041178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-1053s1c1
Sequence:CCGGGCTGGCTTTACTCTACCTCATCTCGAGATGAGGTAGAGTAAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-722s1c1
Sequence:CCGGCCGTCCTCTTATATTACACTTCTCGAGAAGTGTAATATAAGAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-1176s1c1
Sequence:CCGGGTGTTCAGATATGGATGGTATCTCGAGATACCATCCATATCTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029788.2-263s1c1
Sequence:CCGGCGTGTGGTCATTCAAGATCAACTCGAGTTGATCTTGAATGACCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks