EMAIL THIS PAGE TO A FRIEND

RNMTL1

RNA methyltransferase like 1

UniProtKB ID: Q9HC36, Q53GN1, Q86VC3, Q96F76, Q9NVQ5
Gene ID:
Mouse(67390) RNA methyltransferase like 1
Rat(360569) RNA methyltransferase like 1
chicken(417620) RNA methyltransferase like 1
dog(611179) RNA methyltransferase like 1
Horse(100072276) RNA methyltransferase like 1
domestic cat(101089156) RNA methyltransferase like 1
domestic guinea pig(100720969) RNA methyltransferase like 1
naked mole-rat(101711721) RNA methyltransferase like 1
Domestic Rabbit(100338176) RNA methyltransferase like 1
cow(538817) RNA methyltransferase like 1
sheep(101102000) RNA methyltransferase like 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018146 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018146 Rosetta Predictions human pricing
NM_001108282 Rosetta Predictions rat pricing
NM_183263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139303 predicted 684
2 SASI_Hs02_00351378 predicted 730
3 SASI_Hs01_00139304 predicted 697
4 SASI_Hs01_00139305 predicted 811
5 SASI_Hs01_00139306 predicted 1037
6 SASI_Hs01_00139307 predicted 890
7 SASI_Hs01_00139308 predicted 1031
8 SASI_Hs01_00139309 predicted 1337
9 SASI_Hs01_00139311 predicted 951
10 SASI_Hs01_00139312 predicted 636
11 SASI_Hs01_00139310 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237124 predicted 218
2 SASI_Rn02_00237125 predicted 634
3 SASI_Rn02_00237126 predicted 718
4 SASI_Rn02_00237127 predicted 949
5 SASI_Rn02_00237128 predicted 1236
6 SASI_Rn02_00237129 predicted 1113
7 SASI_Rn02_00237130 predicted 320
8 SASI_Rn02_00237131 predicted 925
9 SASI_Rn02_00237132 predicted 856
10 SASI_Rn02_00237133 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350346 predicted 343
2 SASI_Mm01_00028184 predicted 742
3 SASI_Mm02_00350347 predicted 243
4 SASI_Mm01_00028185 predicted 964
5 SASI_Mm02_00350348 predicted 353
6 SASI_Mm02_00350349 predicted 876
7 SASI_Mm02_00350350 predicted 903
8 SASI_Mm02_00350351 predicted 952
9 SASI_Mm02_00350352 predicted 978
10 SASI_Mm02_00350353 predicted 891
11 SASI_Mm01_00028186 predicted 811
12 SASI_Mm01_00028187 predicted 892
13 SASI_Mm01_00028188 predicted 848
14 SASI_Mm01_00028189 predicted 932
15 SASI_Mm01_00028190 predicted 523
16 SASI_Mm01_00028191 predicted 1106
17 SASI_Mm01_00028192 predicted 860
18 SASI_Mm01_00028193 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018146
VALIDATED
RNMTL1 MISSION shRNA Bacterial Glycerol Stock
RNA methyltransferase like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018146.2-1540s21c1
Sequence:CCGGATTCTTCCTGTCGCGTCACTGCTCGAGCAGTGACGCGACAGGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-987s21c1
Sequence:CCGGCCCAGGCTGAGATGTCTAATACTCGAGTATTAGACATCTCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-642s21c1
Sequence:CCGGTCGTAACGCCACAAGGAATAACTCGAGTTATTCCTTGTGGCGTTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-493s21c1
Sequence:CCGGGCTCATTTCAGACGCTCTCAACTCGAGTTGAGAGCGTCTGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-374s21c1
Sequence:CCGGTCTGGGCTTCGCTACGATAAACTCGAGTTTATCGTAGCGAAGCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-421s21c1
Sequence:CCGGCAGTGTAATGACAATAGTAAACTCGAGTTTACTATTGTCATTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-896s1c1
Sequence:CCGGCCCATTATCAATAATCTGGAACTCGAGTTCCAGATTATTGATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-987s1c1
Sequence:CCGGCCCAGGCTGAGATGTCTAATACTCGAGTATTAGACATCTCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-681s1c1
Sequence:CCGGCTGACCATGTTAAGATGACATCTCGAGATGTCATCTTAACATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-595s1c1
Sequence:CCGGCAGCCTCATTAAGGTGAAATTCTCGAGAATTTCACCTTAATGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018146.2-493s1c1
Sequence:CCGGGCTCATTTCAGACGCTCTCAACTCGAGTTGAGAGCGTCTGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018146
VALIDATED
RNMTL1 MISSION shRNA shRNA Plasmid DNA
RNA methyltransferase like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018146.2-1540s21c1
Sequence:CCGGATTCTTCCTGTCGCGTCACTGCTCGAGCAGTGACGCGACAGGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-987s21c1
Sequence:CCGGCCCAGGCTGAGATGTCTAATACTCGAGTATTAGACATCTCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-642s21c1
Sequence:CCGGTCGTAACGCCACAAGGAATAACTCGAGTTATTCCTTGTGGCGTTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-493s21c1
Sequence:CCGGGCTCATTTCAGACGCTCTCAACTCGAGTTGAGAGCGTCTGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-374s21c1
Sequence:CCGGTCTGGGCTTCGCTACGATAAACTCGAGTTTATCGTAGCGAAGCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-421s21c1
Sequence:CCGGCAGTGTAATGACAATAGTAAACTCGAGTTTACTATTGTCATTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-896s1c1
Sequence:CCGGCCCATTATCAATAATCTGGAACTCGAGTTCCAGATTATTGATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-987s1c1
Sequence:CCGGCCCAGGCTGAGATGTCTAATACTCGAGTATTAGACATCTCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-681s1c1
Sequence:CCGGCTGACCATGTTAAGATGACATCTCGAGATGTCATCTTAACATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-595s1c1
Sequence:CCGGCAGCCTCATTAAGGTGAAATTCTCGAGAATTTCACCTTAATGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018146.2-493s1c1
Sequence:CCGGGCTCATTTCAGACGCTCTCAACTCGAGTTGAGAGCGTCTGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018146
VALIDATED
RNMTL1 MISSION shRNA Lentiviral Transduction Particles
RNA methyltransferase like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018146.2-1540s21c1
Sequence:CCGGATTCTTCCTGTCGCGTCACTGCTCGAGCAGTGACGCGACAGGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-987s21c1
Sequence:CCGGCCCAGGCTGAGATGTCTAATACTCGAGTATTAGACATCTCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-642s21c1
Sequence:CCGGTCGTAACGCCACAAGGAATAACTCGAGTTATTCCTTGTGGCGTTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-493s21c1
Sequence:CCGGGCTCATTTCAGACGCTCTCAACTCGAGTTGAGAGCGTCTGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-374s21c1
Sequence:CCGGTCTGGGCTTCGCTACGATAAACTCGAGTTTATCGTAGCGAAGCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018146.2-421s21c1
Sequence:CCGGCAGTGTAATGACAATAGTAAACTCGAGTTTACTATTGTCATTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-896s1c1
Sequence:CCGGCCCATTATCAATAATCTGGAACTCGAGTTCCAGATTATTGATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-987s1c1
Sequence:CCGGCCCAGGCTGAGATGTCTAATACTCGAGTATTAGACATCTCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-681s1c1
Sequence:CCGGCTGACCATGTTAAGATGACATCTCGAGATGTCATCTTAACATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018146.2-595s1c1
Sequence:CCGGCAGCCTCATTAAGGTGAAATTCTCGAGAATTTCACCTTAATGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018146.2-493s1c1
Sequence:CCGGGCTCATTTCAGACGCTCTCAACTCGAGTTGAGAGCGTCTGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183263
VALIDATED
RNMTL1 MISSION shRNA Bacterial Glycerol Stock
RNA methyltransferase like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-919s21c1
Sequence:CCGGCCAGGTTCAGATGTCTGATAACTCGAGTTATCAGACATCTGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-833s21c1
Sequence:CCGGGTGAACAATGTGGAATGGGAACTCGAGTTCCCATTCCACATTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-664s21c1
Sequence:CCGGCCTAGTGTTGATTTGTGACAACTCGAGTTGTCACAAATCAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-523s21c1
Sequence:CCGGCGTCAGCCTCATTAAGGTGAACTCGAGTTCACCTTAATGAGGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-885s1c1
Sequence:CCGGCCAGGTTCAGATGTCTGATAACTCGAGTTATCAGACATCTGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-799s1c1
Sequence:CCGGGTGAACAATGTGGAATGGGAACTCGAGTTCCCATTCCACATTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-489s1c1
Sequence:CCGGCGTCAGCCTCATTAAGGTGAACTCGAGTTCACCTTAATGAGGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-630s1c1
Sequence:CCGGCCTAGTGTTGATTTGTGACAACTCGAGTTGTCACAAATCAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183263.1-1001s1c1
Sequence:CCGGCCAAACTTGAGGTCCAGAGTTCTCGAGAACTCTGGACCTCAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183263
VALIDATED
RNMTL1 MISSION shRNA shRNA Plasmid DNA
RNA methyltransferase like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-919s21c1
Sequence:CCGGCCAGGTTCAGATGTCTGATAACTCGAGTTATCAGACATCTGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-833s21c1
Sequence:CCGGGTGAACAATGTGGAATGGGAACTCGAGTTCCCATTCCACATTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-664s21c1
Sequence:CCGGCCTAGTGTTGATTTGTGACAACTCGAGTTGTCACAAATCAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-523s21c1
Sequence:CCGGCGTCAGCCTCATTAAGGTGAACTCGAGTTCACCTTAATGAGGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-885s1c1
Sequence:CCGGCCAGGTTCAGATGTCTGATAACTCGAGTTATCAGACATCTGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-799s1c1
Sequence:CCGGGTGAACAATGTGGAATGGGAACTCGAGTTCCCATTCCACATTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-489s1c1
Sequence:CCGGCGTCAGCCTCATTAAGGTGAACTCGAGTTCACCTTAATGAGGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-630s1c1
Sequence:CCGGCCTAGTGTTGATTTGTGACAACTCGAGTTGTCACAAATCAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183263.1-1001s1c1
Sequence:CCGGCCAAACTTGAGGTCCAGAGTTCTCGAGAACTCTGGACCTCAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183263
VALIDATED
RNMTL1 MISSION shRNA Lentiviral Transduction Particles
RNA methyltransferase like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-919s21c1
Sequence:CCGGCCAGGTTCAGATGTCTGATAACTCGAGTTATCAGACATCTGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-833s21c1
Sequence:CCGGGTGAACAATGTGGAATGGGAACTCGAGTTCCCATTCCACATTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-664s21c1
Sequence:CCGGCCTAGTGTTGATTTGTGACAACTCGAGTTGTCACAAATCAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183263.5-523s21c1
Sequence:CCGGCGTCAGCCTCATTAAGGTGAACTCGAGTTCACCTTAATGAGGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-885s1c1
Sequence:CCGGCCAGGTTCAGATGTCTGATAACTCGAGTTATCAGACATCTGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-799s1c1
Sequence:CCGGGTGAACAATGTGGAATGGGAACTCGAGTTCCCATTCCACATTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-489s1c1
Sequence:CCGGCGTCAGCCTCATTAAGGTGAACTCGAGTTCACCTTAATGAGGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183263.1-630s1c1
Sequence:CCGGCCTAGTGTTGATTTGTGACAACTCGAGTTGTCACAAATCAACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183263.1-1001s1c1
Sequence:CCGGCCAAACTTGAGGTCCAGAGTTCTCGAGAACTCTGGACCTCAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks